ID: 1197846411

View in Genome Browser
Species Human (GRCh38)
Location X:130808569-130808591
Sequence CCACCAATTAGGTTAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197846407_1197846411 12 Left 1197846407 X:130808534-130808556 CCATAAAACTGGAATTAAAAATG 0: 1
1: 0
2: 2
3: 66
4: 741
Right 1197846411 X:130808569-130808591 CCACCAATTAGGTTAAAAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 132
1197846405_1197846411 23 Left 1197846405 X:130808523-130808545 CCAATATTTAGCCATAAAACTGG 0: 1
1: 0
2: 3
3: 9
4: 141
Right 1197846411 X:130808569-130808591 CCACCAATTAGGTTAAAAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197846411 Original CRISPR CCACCAATTAGGTTAAAAGG AGG Intronic
901898570 1:12337554-12337576 CCAACAATTTTGTCAAAAGGAGG - Intronic
904397141 1:30229558-30229580 ATACCAATTAGGCTAAAAGCAGG + Intergenic
908717626 1:67087282-67087304 ACACAAATTAGGCTAAAAGCAGG + Intergenic
908723263 1:67148461-67148483 ATACCAATTAGGCTAAAAGCAGG - Intronic
908813491 1:68008522-68008544 CTACCAGTTAGGCTACAAGGGGG + Intergenic
917097570 1:171414307-171414329 ATACCAATTAGGCTAAAAGCAGG - Intergenic
922685187 1:227633393-227633415 ATACCAATTAGGCTAAAAGCTGG - Intronic
1066144278 10:32540732-32540754 CCACCCATCAGGCTAAAAGTGGG - Intronic
1071922845 10:90371251-90371273 CTCCCAGTTAGGCTAAAAGGGGG + Intergenic
1072078195 10:92000250-92000272 CAACCCATTTGGTTTAAAGGTGG - Intronic
1072346980 10:94517602-94517624 CCACCAGTTAAGTTATATGGTGG - Intronic
1074978499 10:118600122-118600144 ATACCAATTAGGCTAAAAGCAGG - Intergenic
1079933293 11:26591040-26591062 ATACCAATTAGGCTAAAAGCAGG - Intronic
1081459621 11:43260047-43260069 CTACCAATTATCTGAAAAGGGGG + Intergenic
1085901006 11:80699804-80699826 ATACCAATTAGGCTAAAAGCAGG - Intergenic
1086230463 11:84563402-84563424 TCACTAATTATGTTAGAAGGAGG - Intronic
1086511237 11:87560155-87560177 ATACCAATTAGGCTAAAAGCAGG - Intergenic
1090684621 11:129101181-129101203 TCATCAAATAGGATAAAAGGGGG + Intronic
1092071966 12:5638633-5638655 CTTCCAACTAGGTCAAAAGGAGG + Intronic
1092294362 12:7186350-7186372 ACACCAATTAGGCTAAAAGCAGG + Intergenic
1094185826 12:27641762-27641784 ATACCAATTAGGCTAAAAGCAGG + Intronic
1095638762 12:44462518-44462540 TAACCAATAAAGTTAAAAGGGGG + Intergenic
1097558865 12:61175609-61175631 TCACCAATTAGATTGAAAAGGGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098984838 12:77001216-77001238 ATACCAATTAGGCTAAAAGCAGG + Intergenic
1103802524 12:123548561-123548583 ATACCAATTAGGCTAAAAGCAGG + Intergenic
1103872837 12:124103022-124103044 ATACCAATTAGGCTAAAAGCAGG - Intronic
1108032093 13:46242576-46242598 TCACCAATTAGATTAAATGCAGG + Intronic
1113592310 13:111509603-111509625 ATACCAATTAGGCTAAAAGCAGG - Intergenic
1113922123 13:113919140-113919162 CGACCCATTGGGTTATAAGGTGG + Intergenic
1115151627 14:30293028-30293050 ATACCAATTAGGCTAAAAGCAGG + Intergenic
1115320429 14:32075224-32075246 CTACCAAGTAGGTTAAGAGTAGG - Intergenic
1120108018 14:80518210-80518232 ATACCAATTAGGCTAAAAGCAGG - Intronic
1120341399 14:83225459-83225481 ATACCAATTAGGCTAAAAGCAGG + Intergenic
1124858100 15:33410587-33410609 CCAACAATTAGATTAAAATAAGG - Intronic
1126153926 15:45547629-45547651 ATACCAATTAGGCTAAAAGCAGG - Intergenic
1126791072 15:52221754-52221776 CCCCCAGTTAGGTTAAAACAGGG + Intronic
1127396494 15:58547604-58547626 CCACAGATTAGGTTAAAATTTGG + Intronic
1127843887 15:62852907-62852929 CCAACAACAAGGTTCAAAGGGGG + Intergenic
1131244305 15:90776919-90776941 TTACCAATTAGGTTATATGGTGG - Intronic
1131629107 15:94157384-94157406 ATACCAATTAGGCTAAAAGCAGG + Intergenic
1132529731 16:440501-440523 CCACCAGGTAGGAGAAAAGGGGG - Intronic
1134891536 16:17845641-17845663 CCACCAAGAAGATTAAAAGGTGG - Intergenic
1137489371 16:48918800-48918822 GCACCAATGAGGTGAACAGGAGG + Intergenic
1147255853 17:39181570-39181592 CCCCCACTGAGGTTAAGAGGAGG - Intronic
1156839740 18:41597271-41597293 CCAGCAATGAGAATAAAAGGTGG - Intergenic
1165823160 19:38690029-38690051 ATACCAATTAGGTTAAAAGCAGG + Intronic
1166165700 19:40986859-40986881 ATACCAATTAGGCTAAAAGTAGG - Intergenic
1167728371 19:51234750-51234772 CCATCACTTAGGGTCAAAGGTGG - Intronic
927820359 2:26258838-26258860 ATATCAATTAGGTTAAAAGCAGG - Intronic
931996387 2:67843079-67843101 CCACCCAGTAGGTTAAGAGAGGG + Intergenic
933121808 2:78547280-78547302 ATACCAATTAGGCTAAAAGCAGG - Intergenic
935930968 2:108125050-108125072 CAACCAGCTAGGTCAAAAGGGGG + Intergenic
939493013 2:142899325-142899347 ACACAAATTAGGCTAAAAGCAGG - Intronic
940432211 2:153606106-153606128 GCACCCATTAGGTTGAAAGCAGG + Intergenic
941892498 2:170596587-170596609 CCACCCATGAGGTTTATAGGGGG + Intronic
942407950 2:175675639-175675661 TCTCCAATTATGCTAAAAGGTGG + Intergenic
943073665 2:183171104-183171126 CCACAAAGAAGGTTAAAGGGGGG - Intergenic
943442033 2:187936860-187936882 CCAACAATTAGATTCAAAGTTGG + Intergenic
943462408 2:188184923-188184945 ACACCAATTAAGTTAAAAACAGG - Intergenic
945004019 2:205383902-205383924 TCACAAATTAGGTTAGAAGAAGG - Intronic
1169764042 20:9129282-9129304 CCACCAATTAGGATAGAAATTGG + Intronic
1170648083 20:18214316-18214338 CTACCATTTATGTTAAAAGAGGG + Intergenic
1177436478 21:21060748-21060770 CCAACAAATAGGTTAAAAATGGG - Intronic
1178518133 21:33265900-33265922 CCACTAATCAAGTTAAAAAGAGG + Intronic
1178760964 21:35402554-35402576 CCACCCATTAGTTTACAAGTGGG - Intronic
1182344444 22:29651265-29651287 CCAATACTTAGGTTAAACGGAGG - Intronic
953515788 3:43590954-43590976 ATACCAATTAGGCTAAAAGCAGG + Intronic
953592018 3:44267079-44267101 CGACCACTTAGATTCAAAGGAGG - Exonic
955978715 3:64502912-64502934 CTACGAATTTGGTGAAAAGGAGG - Intergenic
957186417 3:76947150-76947172 CCACAAATTAGGGGAAAATGAGG + Intronic
957815057 3:85287111-85287133 CCACCAATTCAATTAAAAGTAGG - Intronic
959340705 3:105126269-105126291 CCAGCAATGACCTTAAAAGGAGG + Intergenic
959885753 3:111497636-111497658 ATACCAATTAGGGTAAAAGCAGG - Intronic
960277817 3:115746871-115746893 ATACCAATTAGGCTAAAAGCAGG + Intergenic
963255642 3:143142250-143142272 ATACCAATTAGGCTAAAAGCAGG + Intergenic
964830633 3:160880307-160880329 CAACCAATTAAGTTAAAATTAGG + Intronic
964980055 3:162667293-162667315 ACACCAATTAGGCTAAAAGCAGG - Intergenic
965054324 3:163695073-163695095 ATACCAATTAGGCTAAAAGCAGG - Intergenic
965373776 3:167896492-167896514 CCACAAATTAGATTAAATAGAGG + Intergenic
970630041 4:17931220-17931242 CCACCAATTAGGTTAACTAGTGG + Intronic
972008424 4:34141764-34141786 CCACCAATTATGTTAGAAAATGG + Intergenic
973753621 4:54049655-54049677 CCACCAATAACATTAAAAGCTGG - Intronic
974190518 4:58496787-58496809 ATACCAATTAGGCTAAAAGCAGG - Intergenic
974648532 4:64725218-64725240 ATACCAATTAGGCTAAAAGCAGG - Intergenic
977342052 4:95771499-95771521 ATACCAATTAGGCTAAAAGCAGG + Intergenic
984257811 4:177408525-177408547 ATACCAATTAGGCTAAAAGCAGG - Intergenic
984280708 4:177666874-177666896 ATACCAATTAGGCTAAAAGCAGG - Intergenic
987129581 5:14848292-14848314 ATACCAATTAGGCTAAAAGCAGG + Intronic
987129682 5:14848947-14848969 ATACCAATTAGGCTAAAAGCTGG - Intronic
988669406 5:33364750-33364772 CCACCCATAAGGTAAGAAGGTGG + Intergenic
989406071 5:41062400-41062422 CCACCACTTAGGTCAAGAAGTGG - Intronic
993630045 5:90275665-90275687 CCACCCATTATGTTAAATGGTGG - Intergenic
993642123 5:90417920-90417942 ATACCAATTAGGCTAAAAGCAGG - Intergenic
995348934 5:111152929-111152951 CGAGCAATAAGGTTAAAGGGAGG + Intergenic
995573994 5:113510879-113510901 GCAGCAATGAGGTTAATAGGAGG - Intergenic
995856536 5:116598529-116598551 CCACCAATTAGACTAAGAGCTGG - Intergenic
996939841 5:128991175-128991197 ATACCAATTAGGCTAAAAGCAGG - Intronic
1001597188 5:172905918-172905940 ATACCAATTAGGCTAAAAGCAGG - Intronic
1002391082 5:178912286-178912308 TCACCAATGAGGTGAATAGGAGG + Intronic
1008086585 6:47251759-47251781 CCTCCAATTAAGTAAAATGGCGG - Intronic
1009519587 6:64664308-64664330 ACACCAATTAGGCTAAAAACAGG - Intronic
1009885167 6:69616793-69616815 ATACCAATTAGGCTAAAAGCAGG + Intergenic
1015087523 6:129313311-129313333 CCACCAACTAGAAAAAAAGGTGG - Intronic
1017155983 6:151323064-151323086 TCATCAATTAGGATAAAAGCAGG - Intronic
1020208989 7:6143818-6143840 CCACCAATAATGTTAAAATTAGG - Intronic
1021126183 7:16853113-16853135 ATACCAATTAGGCTAAAAGCAGG + Intergenic
1024318686 7:48044464-48044486 ATACCAATTAGGCTAAAAGCGGG - Intronic
1024347117 7:48324353-48324375 TCATCAATTAAGTTAAAATGAGG - Intronic
1027968836 7:85050037-85050059 CCACCCATTGACTTAAAAGGTGG + Intronic
1028147091 7:87330288-87330310 ATACCAATTAGGCTAAAAGCAGG - Intergenic
1028294281 7:89108171-89108193 CCCACAAAGAGGTTAAAAGGAGG - Intronic
1030664503 7:112260283-112260305 GCACCAAAAAGATTAAAAGGAGG + Intronic
1031616594 7:123888947-123888969 CCCCAAATTGGGTTAACAGGTGG + Intergenic
1033428892 7:141270502-141270524 CCAGAAATAATGTTAAAAGGTGG - Intronic
1036917247 8:12815860-12815882 CCACCAACTACTTAAAAAGGGGG - Intergenic
1037054811 8:14426368-14426390 CCCCCAATTTGGTTAACAGAAGG + Intronic
1037571255 8:20159449-20159471 ATACCAATTAGGCTAAAAGCAGG + Intronic
1041699930 8:60777092-60777114 CCACAAATTAAGCTAAAGGGAGG - Intronic
1044313932 8:90727385-90727407 TCATCAAATAGGATAAAAGGGGG + Intronic
1045664293 8:104468693-104468715 ATACAAATTAGGTTAAAAGCAGG + Intergenic
1045863548 8:106839631-106839653 ATACCAATTAGGCTAAAAGCAGG - Intergenic
1047443594 8:124900379-124900401 CTACCAATTAGGCTAAAAGCAGG - Intergenic
1047444478 8:124907059-124907081 CCACCAATTAGGCTAAAAGCAGG - Intergenic
1050263192 9:3862704-3862726 CGATCAACTAGATTAAAAGGCGG + Intronic
1058190050 9:101902741-101902763 CCAGCAATTTGGTTAAGTGGAGG - Intergenic
1059641103 9:116217918-116217940 CCACCAAATAGGTTACATGCAGG - Intronic
1187629858 X:21157121-21157143 ATACCAATTAGGCTAAAAGCAGG + Intergenic
1188789378 X:34389099-34389121 CCACAAATTAGGTTAACAATCGG - Intergenic
1190266168 X:48828327-48828349 CAACAAACTAGGTTAAAAAGGGG - Intergenic
1191695599 X:63986377-63986399 CAATCAAATAGGATAAAAGGGGG + Intergenic
1192803148 X:74486121-74486143 ATACCAATTAGGCTAAAAGCAGG - Intronic
1193301895 X:79899114-79899136 CCACTAGCTAGGCTAAAAGGAGG + Intergenic
1194077269 X:89411807-89411829 CCAACAATTATGTGAAAAGATGG - Intergenic
1195243639 X:102977574-102977596 ACACCAATTAGGCTAGAAGCAGG + Intergenic
1195505119 X:105647471-105647493 ATACCAATTAGGCTAAAAGCAGG - Intronic
1196993596 X:121356386-121356408 ATACCAATTAGGCTAAAAGCAGG + Intergenic
1197846411 X:130808569-130808591 CCACCAATTAGGTTAAAAGGAGG + Intronic
1199579892 X:149350681-149350703 CCACCAATTGGGCAAAAGGGAGG - Intergenic
1200429914 Y:3067353-3067375 CCAACAATTATGTGAAAAGATGG - Intergenic
1201329198 Y:12799764-12799786 ATACCAATTAGGCTAAAAGCAGG + Intronic