ID: 1197854498

View in Genome Browser
Species Human (GRCh38)
Location X:130900771-130900793
Sequence CAGGTACAAAATGCTATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197854498_1197854503 18 Left 1197854498 X:130900771-130900793 CCCTCCATAGCATTTTGTACCTG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1197854503 X:130900812-130900834 CTACAGTATCTCAGAACTGTGGG 0: 1
1: 0
2: 3
3: 8
4: 136
1197854498_1197854502 17 Left 1197854498 X:130900771-130900793 CCCTCCATAGCATTTTGTACCTG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1197854502 X:130900811-130900833 ACTACAGTATCTCAGAACTGTGG 0: 1
1: 0
2: 2
3: 9
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197854498 Original CRISPR CAGGTACAAAATGCTATGGA GGG (reversed) Intronic
901773772 1:11545139-11545161 CTGGGACAAAATGCCATGTAAGG + Intergenic
903791854 1:25898628-25898650 CAAGTACAAAATCCTCAGGAAGG + Intronic
905780139 1:40701611-40701633 CAAATGCAAAATGCTATGGGAGG - Intronic
906845018 1:49182266-49182288 TAGAAACAAAATGCTAAGGAAGG - Intronic
908588274 1:65598298-65598320 CTGGTAGAAAATGCTGTGCAGGG - Intronic
909290791 1:73880679-73880701 CAGCTAGAAGAAGCTATGGAGGG + Intergenic
911687818 1:100797429-100797451 CACTGACAAGATGCTATGGATGG + Intergenic
916216317 1:162398017-162398039 CAGGGACACAATGGTAGGGAAGG + Intronic
920793131 1:209111632-209111654 CAGGCAAAAAGTGCCATGGAAGG - Intergenic
922215591 1:223517046-223517068 CATATATAAAATGCTATCGATGG + Intergenic
924204522 1:241698185-241698207 AAAATACAAAATGCTATAGAAGG - Intronic
1063327380 10:5117963-5117985 CAGGGGCAGAATGCTATGGTTGG - Intronic
1063488994 10:6446293-6446315 GAGGCACATTATGCTATGGAAGG - Intronic
1067578066 10:47420259-47420281 CATGTATAAGATGCTAAGGACGG + Intergenic
1067667305 10:48289309-48289331 CATGTAAAATATGCCATGGATGG - Intergenic
1070943179 10:80365256-80365278 CAGAAACAGAATGCTATGTATGG + Intronic
1074704245 10:116117389-116117411 AAGGGACAAAGTGCTATGGGAGG - Intronic
1077798684 11:5516885-5516907 CAGGGACAAAGTTCTCTGGATGG + Intronic
1080119249 11:28657377-28657399 AAGGTACAAATTGCTTTGGGAGG + Intergenic
1083373093 11:62197136-62197158 TAGGAACAAAAAGCTATAGAGGG - Intergenic
1085751602 11:79167174-79167196 CAGGCAGAAAATGCTAAGTATGG - Intronic
1088031284 11:105253929-105253951 CAGGTACAAGATGTCATGCAGGG - Intergenic
1089154949 11:116394565-116394587 CAGGGACAAAACGCTCTGTAGGG + Intergenic
1089625757 11:119749689-119749711 CATGTAGAAAGTGCTATAGAAGG + Intergenic
1097961254 12:65533925-65533947 CAGGTATGAAAAGCTATGGGGGG + Intergenic
1101119388 12:101563549-101563571 AAGGTACCAAATGCTGTTGAGGG - Intergenic
1105713510 13:23037131-23037153 CAGGTGCAAAATGCTACATATGG - Intergenic
1107891134 13:44915714-44915736 CAGGTACTTAATGATATGAAAGG - Intergenic
1108246832 13:48524639-48524661 CAGGTACAAAAGTTTTTGGAGGG - Exonic
1115817346 14:37177531-37177553 CAGGTAAAACATACTATGGCTGG - Intergenic
1116910675 14:50460188-50460210 GAGGTAAAAGGTGCTATGGAGGG - Intronic
1122461359 14:101898185-101898207 AAGGGAAAAAAAGCTATGGAAGG + Intronic
1125214002 15:37248366-37248388 CAGGTATAAAATGTTATACATGG - Intergenic
1129174174 15:73828143-73828165 GAGGGAACAAATGCTATGGAGGG + Intergenic
1129272269 15:74425218-74425240 CACGTAGTAAATGCGATGGAAGG - Intronic
1136126959 16:28190612-28190634 GAGGGAAAAAATGCTATGAAAGG + Intronic
1138403369 16:56767611-56767633 CAGGTAGAAACCGCCATGGAAGG + Intronic
1143328375 17:6116604-6116626 CAGCTGGAAAATGCTATGAAAGG - Intronic
1144754338 17:17670023-17670045 CAGTTACAGAATGCTGAGGACGG - Intergenic
1145329701 17:21861100-21861122 CTGGAACAAAATGCTATCGAAGG + Intergenic
1146819071 17:35969940-35969962 CAGGTACAAAGGGCCCTGGATGG + Intergenic
1146921846 17:36718434-36718456 CAGGACCAAAATGCTATGTTAGG - Intergenic
1148345711 17:46902506-46902528 GAGAGACAAAATGCTATGGCAGG + Intergenic
1148996730 17:51716672-51716694 CCCCTACAAGATGCTATGGAGGG - Intronic
1150348088 17:64420206-64420228 CAGGAACAACATCCTATGAATGG - Intergenic
1150599098 17:66634974-66634996 CAGAAATAAAATGCTCTGGAAGG + Intronic
1152014107 17:77738417-77738439 CAGGTAAAATATGGTATTGAGGG + Intergenic
1153773617 18:8434576-8434598 CAGGTACATAATGCCAGGCAGGG - Intergenic
1155031226 18:21985946-21985968 CAGCTACAAAATGCTAATGAGGG + Intergenic
1157901657 18:51523930-51523952 ACGGTTCAAAATGCTCTGGAGGG + Intergenic
1158819355 18:61141471-61141493 CAGGTAACAAGTACTATGGAAGG + Intergenic
1159859185 18:73626958-73626980 TAGGTACAAAGTGCTATTTAAGG + Intergenic
1161651584 19:5489037-5489059 AAGGTGAGAAATGCTATGGAAGG - Intergenic
1166749574 19:45158568-45158590 CAGGTGCAAGATGCTAGGCAGGG + Intronic
1166836867 19:45672599-45672621 GAGGTACAAAATGTTAAGGCTGG - Intronic
1167470289 19:49671950-49671972 AAGGCCCAAAGTGCTATGGAAGG - Intronic
926512553 2:13800647-13800669 CAGGTAGACAAGTCTATGGAAGG + Intergenic
927689951 2:25201512-25201534 CAGGTACGAAATGATGTGGCTGG + Intergenic
931514505 2:63038814-63038836 AAGGTAAGAAATGCTATGGTGGG + Exonic
935891755 2:107686769-107686791 CAGGTGCAAAATGGTGGGGAGGG - Intergenic
940797775 2:158098640-158098662 CACGTACAAAATGGAATGGTGGG - Intronic
942110560 2:172678295-172678317 CAGGTACAAATTGGAATTGATGG + Intergenic
942664345 2:178300981-178301003 AAAGTACAAAATGATATGGCAGG + Intronic
943392296 2:187285022-187285044 GAGGAACAAAATACTAAGGATGG - Intergenic
944597915 2:201278879-201278901 CAGGGACAAAATGCTGGAGAAGG + Intronic
945816699 2:214613595-214613617 CAGGTACACACTGCTATGCCTGG + Intergenic
1169480972 20:5980231-5980253 AAGGTAAAAAGTGCTATGGAAGG - Intronic
1169534725 20:6525672-6525694 CAGGAACAAAATGCTTCGGTGGG + Intergenic
1170398096 20:15949654-15949676 CAGGCAGAAAAATCTATGGAAGG - Intronic
1178163732 21:29948255-29948277 CAGGTACATAATGCTATGCCTGG + Intergenic
1181484215 22:23220266-23220288 CAGGGTCAAAATCCCATGGACGG - Intronic
949987054 3:9549719-9549741 CAGGTACAAAATCATATGAGAGG + Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
952324097 3:32305393-32305415 CAGGTACAAAATGTCACTGATGG + Intronic
953396344 3:42573699-42573721 AAAGTAAAAAATGCAATGGATGG + Intronic
956308325 3:67850950-67850972 TAGGTACAGAAAGCTAGGGAAGG + Intergenic
956461252 3:69474853-69474875 CAGGGATAAAATGCTATCAAAGG + Intronic
956597205 3:70980675-70980697 CAGGGATAAAATGCTCTGCACGG - Intronic
956971835 3:74535548-74535570 CAGATACAAAAGCATATGGAGGG + Intergenic
957224421 3:77425500-77425522 CAGGGACAAAGTGCTAAGCAGGG + Intronic
957956812 3:87197684-87197706 CAGGTATAAAATCCAGTGGATGG - Intergenic
958083722 3:88779929-88779951 CAGGGACAGAATGATATGGTAGG - Intergenic
960908582 3:122625789-122625811 GCGGTACAAAAAGCCATGGACGG - Intronic
961774653 3:129276106-129276128 AAGGTATACAATTCTATGGAAGG - Intronic
965178778 3:165372805-165372827 CAGGCTCAAAATTCTAAGGATGG - Intergenic
968975329 4:3819293-3819315 CAGAGGCAGAATGCTATGGACGG - Intergenic
973027329 4:45289109-45289131 CAGGTACAAAAATCTATATAAGG - Intergenic
974285248 4:59856384-59856406 CATTTAAAAAATGCTATGGATGG - Intergenic
975678279 4:76849859-76849881 CAGGAGAAAAATGGTATGGATGG + Intergenic
976080651 4:81351188-81351210 CAGGCTTAAAAGGCTATGGAAGG + Intergenic
976353062 4:84082652-84082674 CAGGTACAGAAATCAATGGAAGG - Intergenic
976418754 4:84812669-84812691 CATGTACAAAATGCTATCACTGG + Intronic
977145170 4:93430529-93430551 CATGGTCAAAGTGCTATGGAGGG + Intronic
978190971 4:105911642-105911664 CAAGAAGAAAATGCTGTGGAAGG + Intronic
981411871 4:144441959-144441981 CAGGGGCAAAATGATATGGTTGG - Intergenic
981778650 4:148399760-148399782 CAGGAATAAAAAGCCATGGAAGG - Intronic
986229883 5:5853375-5853397 CAGCTGCAGACTGCTATGGATGG - Intergenic
986986558 5:13506915-13506937 CAGGTGAGAAATGCTAGGGAGGG + Intergenic
989200047 5:38754128-38754150 CAGGTGCTAAAGGCTCTGGAAGG + Intergenic
991244073 5:64490217-64490239 CACGTACAAAGTGCTTTGGCTGG + Intergenic
991554914 5:67884569-67884591 CAAGTACAAAATGATATATAGGG + Intergenic
992855301 5:80854579-80854601 CATGTACAAAAGGGTATGCAGGG - Intronic
994878254 5:105451987-105452009 CAGGGACAGAATGATATGGTTGG + Intergenic
996261806 5:121480614-121480636 TAGGAACAAAATACTATGTAAGG + Intergenic
997275260 5:132581534-132581556 CAGGTAAAATATACTCTGGAAGG - Intronic
998557359 5:143138525-143138547 AAGATACAAAATGATATGAAGGG + Intronic
1000543957 5:162576132-162576154 TAGGTACAAAATGTTCAGGATGG - Intergenic
1007492176 6:42231740-42231762 TAGGTAGAAAATGCCATTGATGG - Intronic
1007802552 6:44408870-44408892 CAGGTACAAAAGACTAATGAAGG - Intronic
1009027334 6:58015865-58015887 CAGGTATAGTATGCCATGGATGG + Intergenic
1009202872 6:60767349-60767371 CAGGTATAATATGCCATGGATGG + Intergenic
1009488039 6:64250341-64250363 CAGGTGAAAAATGGTATTGAGGG - Intronic
1015651957 6:135472284-135472306 CAGACACAAAAGGCTATAGATGG - Intronic
1015879444 6:137856556-137856578 AAGGTACAAAATGCTTTCCAAGG - Intergenic
1021240910 7:18200069-18200091 CAGGTACAAAATGTTACAAATGG - Intronic
1022666212 7:32413623-32413645 GATGAAAAAAATGCTATGGATGG + Intergenic
1026791404 7:73334662-73334684 CAAGAACAGAATGCTAGGGAGGG - Intronic
1026803463 7:73414659-73414681 CAAGAACAGAATGCTAGGGAGGG + Intergenic
1026988420 7:74569334-74569356 CAGTTACAAAATGGGAAGGAAGG - Intronic
1028753232 7:94406247-94406269 CAGGGACACAATGGTCTGGATGG + Exonic
1029197395 7:98815102-98815124 CTGGTCCAAAAAGATATGGATGG + Intergenic
1029792798 7:102863208-102863230 AAGGTACAAAATGCAGAGGAAGG - Intronic
1030870185 7:114746232-114746254 CAGGTAAATACTGCAATGGATGG - Intergenic
1032271920 7:130416806-130416828 CAGGCACAGAGAGCTATGGATGG - Intronic
1034390303 7:150781931-150781953 CAGTTACAAAATGCTCTAGAAGG + Intergenic
1042907306 8:73785068-73785090 CAAGTACAAAATGCTAGGACAGG - Intronic
1044275976 8:90299999-90300021 CAAGAAAAAAGTGCTATGGAAGG + Intergenic
1044874061 8:96646811-96646833 CAGAGACAAAATGCTATGGGAGG - Intronic
1045132989 8:99178418-99178440 TAAGTACAAAATGCTATACAAGG - Intronic
1048213245 8:132474797-132474819 GAGGTACAAAATTCTATGCCTGG + Intronic
1049928450 9:432610-432632 AAGGAGCTAAATGCTATGGAAGG + Intronic
1051192107 9:14524125-14524147 TAGGTACAAAATGCTGTTTAGGG + Intergenic
1051812751 9:21068745-21068767 CAGGTAGTAGATGCAATGGAGGG + Intergenic
1186083637 X:5961988-5962010 CAGGTATAAGATGCCATGAAGGG - Intronic
1186551725 X:10513146-10513168 CAGGTAAAAAATGATATGTCTGG + Intronic
1187355591 X:18567583-18567605 TACGTACAAAATGCTTTGGCTGG + Intronic
1187638564 X:21261424-21261446 CAGATGCACAATTCTATGGAAGG - Intergenic
1188848354 X:35101934-35101956 CAGGTACTGGATGCTAAGGAAGG - Intergenic
1191054090 X:56224198-56224220 CAGGTAAGAAATGTTATGGTGGG + Intergenic
1192309964 X:70003067-70003089 CAGGTCTAAAATGCTATACAAGG - Intronic
1192699753 X:73456085-73456107 CAGATACAAAATGCAAAGAAAGG - Intergenic
1196033141 X:111113227-111113249 TAGGCACAAGATGCTTTGGAGGG - Intronic
1196502922 X:116406542-116406564 CAGGCACAAAATGCTATGGGAGG - Intergenic
1197854498 X:130900771-130900793 CAGGTACAAAATGCTATGGAGGG - Intronic
1198677162 X:139143629-139143651 CAGGTCCAAAATGGGATGAATGG - Intronic
1199971730 X:152866618-152866640 CAAGCACAGAATGCTAAGGATGG - Intronic