ID: 1197858616

View in Genome Browser
Species Human (GRCh38)
Location X:130946392-130946414
Sequence AAACTTGTATGAACCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197858615_1197858616 14 Left 1197858615 X:130946355-130946377 CCAAAACTGGGAGGGATTTATTC No data
Right 1197858616 X:130946392-130946414 AAACTTGTATGAACCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197858616 Original CRISPR AAACTTGTATGAACCACAGC AGG Intergenic
No off target data available for this crispr