ID: 1197864987

View in Genome Browser
Species Human (GRCh38)
Location X:131008123-131008145
Sequence GTAACGGTGTTTACTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197864987_1197864999 22 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197864999 X:131008168-131008190 CTGGGCAGGGGCTGAAGATGGGG No data
1197864987_1197864995 10 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197864995 X:131008156-131008178 AGCCAGGAAAGGCTGGGCAGGGG No data
1197864987_1197864990 -1 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197864990 X:131008145-131008167 CTCATCTAATTAGCCAGGAAAGG No data
1197864987_1197864991 3 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197864991 X:131008149-131008171 TCTAATTAGCCAGGAAAGGCTGG No data
1197864987_1197865000 28 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197865000 X:131008174-131008196 AGGGGCTGAAGATGGGGCCTTGG No data
1197864987_1197864989 -6 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197864989 X:131008140-131008162 CGTTACTCATCTAATTAGCCAGG No data
1197864987_1197864993 8 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197864993 X:131008154-131008176 TTAGCCAGGAAAGGCTGGGCAGG No data
1197864987_1197864998 21 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197864998 X:131008167-131008189 GCTGGGCAGGGGCTGAAGATGGG No data
1197864987_1197864997 20 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197864997 X:131008166-131008188 GGCTGGGCAGGGGCTGAAGATGG No data
1197864987_1197864994 9 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197864994 X:131008155-131008177 TAGCCAGGAAAGGCTGGGCAGGG No data
1197864987_1197864992 4 Left 1197864987 X:131008123-131008145 CCAGGGACAGTAAACACCGTTAC No data
Right 1197864992 X:131008150-131008172 CTAATTAGCCAGGAAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197864987 Original CRISPR GTAACGGTGTTTACTGTCCC TGG (reversed) Intergenic
No off target data available for this crispr