ID: 1197865748

View in Genome Browser
Species Human (GRCh38)
Location X:131014859-131014881
Sequence GGTCCCAGTGCAGCAATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197865741_1197865748 2 Left 1197865741 X:131014834-131014856 CCTCAGGCAGGAGCCATGGCTAG No data
Right 1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG No data
1197865738_1197865748 12 Left 1197865738 X:131014824-131014846 CCTTTGCAGCCCTCAGGCAGGAG No data
Right 1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG No data
1197865734_1197865748 19 Left 1197865734 X:131014817-131014839 CCGGGACCCTTTGCAGCCCTCAG No data
Right 1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG No data
1197865737_1197865748 13 Left 1197865737 X:131014823-131014845 CCCTTTGCAGCCCTCAGGCAGGA No data
Right 1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG No data
1197865733_1197865748 26 Left 1197865733 X:131014810-131014832 CCTATAGCCGGGACCCTTTGCAG No data
Right 1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG No data
1197865740_1197865748 3 Left 1197865740 X:131014833-131014855 CCCTCAGGCAGGAGCCATGGCTA No data
Right 1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197865748 Original CRISPR GGTCCCAGTGCAGCAATGGG GGG Intergenic
No off target data available for this crispr