ID: 1197867160

View in Genome Browser
Species Human (GRCh38)
Location X:131031150-131031172
Sequence GAAGCACTTTAGTCGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197867157_1197867160 30 Left 1197867157 X:131031097-131031119 CCATAGCACACAGCAGTATTTCT No data
Right 1197867160 X:131031150-131031172 GAAGCACTTTAGTCGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197867160 Original CRISPR GAAGCACTTTAGTCGAGGCC TGG Intergenic
No off target data available for this crispr