ID: 1197867255

View in Genome Browser
Species Human (GRCh38)
Location X:131032493-131032515
Sequence GAGATCAGTAGGCAGACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197867255_1197867258 0 Left 1197867255 X:131032493-131032515 CCAGCTGTCTGCCTACTGATCTC No data
Right 1197867258 X:131032516-131032538 CTCTGCCTTCTGTATGCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197867255 Original CRISPR GAGATCAGTAGGCAGACAGC TGG (reversed) Intergenic
No off target data available for this crispr