ID: 1197868103

View in Genome Browser
Species Human (GRCh38)
Location X:131039666-131039688
Sequence CTTTAACCCTTTAAGATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197868101_1197868103 -1 Left 1197868101 X:131039644-131039666 CCTAAGGATTTGAGATAAGGCAC No data
Right 1197868103 X:131039666-131039688 CTTTAACCCTTTAAGATCTAGGG No data
1197868095_1197868103 28 Left 1197868095 X:131039615-131039637 CCCAAATTCTTAATTTCGAAACA No data
Right 1197868103 X:131039666-131039688 CTTTAACCCTTTAAGATCTAGGG No data
1197868096_1197868103 27 Left 1197868096 X:131039616-131039638 CCAAATTCTTAATTTCGAAACAT No data
Right 1197868103 X:131039666-131039688 CTTTAACCCTTTAAGATCTAGGG No data
1197868100_1197868103 0 Left 1197868100 X:131039643-131039665 CCCTAAGGATTTGAGATAAGGCA No data
Right 1197868103 X:131039666-131039688 CTTTAACCCTTTAAGATCTAGGG No data
1197868094_1197868103 29 Left 1197868094 X:131039614-131039636 CCCCAAATTCTTAATTTCGAAAC No data
Right 1197868103 X:131039666-131039688 CTTTAACCCTTTAAGATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197868103 Original CRISPR CTTTAACCCTTTAAGATCTA GGG Intergenic
No off target data available for this crispr