ID: 1197868496

View in Genome Browser
Species Human (GRCh38)
Location X:131043670-131043692
Sequence CAACCACCTGTGGCTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197868487_1197868496 30 Left 1197868487 X:131043617-131043639 CCAGAGAGGTTGGTGCAGTCTGT No data
Right 1197868496 X:131043670-131043692 CAACCACCTGTGGCTTTCCTGGG No data
1197868492_1197868496 -1 Left 1197868492 X:131043648-131043670 CCAAGCCAGGTGGACACAGCGAC No data
Right 1197868496 X:131043670-131043692 CAACCACCTGTGGCTTTCCTGGG No data
1197868490_1197868496 4 Left 1197868490 X:131043643-131043665 CCAGCCCAAGCCAGGTGGACACA No data
Right 1197868496 X:131043670-131043692 CAACCACCTGTGGCTTTCCTGGG No data
1197868493_1197868496 -6 Left 1197868493 X:131043653-131043675 CCAGGTGGACACAGCGACAACCA No data
Right 1197868496 X:131043670-131043692 CAACCACCTGTGGCTTTCCTGGG No data
1197868491_1197868496 0 Left 1197868491 X:131043647-131043669 CCCAAGCCAGGTGGACACAGCGA No data
Right 1197868496 X:131043670-131043692 CAACCACCTGTGGCTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197868496 Original CRISPR CAACCACCTGTGGCTTTCCT GGG Intergenic
No off target data available for this crispr