ID: 1197870389

View in Genome Browser
Species Human (GRCh38)
Location X:131058236-131058258
Sequence CGTGACATGCTCGAGGTGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197870381_1197870389 -4 Left 1197870381 X:131058217-131058239 CCGGAGGCCCTGCCCCCTTCGTG 0: 1
1: 0
2: 3
3: 26
4: 234
Right 1197870389 X:131058236-131058258 CGTGACATGCTCGAGGTGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 41
1197870374_1197870389 24 Left 1197870374 X:131058189-131058211 CCTCTCTTCTGGCAGGAGGGGGG 0: 1
1: 0
2: 0
3: 44
4: 342
Right 1197870389 X:131058236-131058258 CGTGACATGCTCGAGGTGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 41
1197870380_1197870389 -3 Left 1197870380 X:131058216-131058238 CCCGGAGGCCCTGCCCCCTTCGT 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1197870389 X:131058236-131058258 CGTGACATGCTCGAGGTGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 41
1197870379_1197870389 -2 Left 1197870379 X:131058215-131058237 CCCCGGAGGCCCTGCCCCCTTCG 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1197870389 X:131058236-131058258 CGTGACATGCTCGAGGTGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197870389 Original CRISPR CGTGACATGCTCGAGGTGTC CGG Exonic
912708259 1:111930825-111930847 CGTGACATGCTGGAAATGCCAGG + Intronic
1063954761 10:11255710-11255732 TGTGACATACTCGGGGTGACTGG - Intronic
1068934255 10:62620834-62620856 CGTGACATGCTTGCCCTGTCTGG + Intronic
1075240824 10:120776839-120776861 TGTGTCATGCCCGAAGTGTCTGG - Intergenic
1075587519 10:123668206-123668228 GGGGACAGGCTGGAGGTGTCAGG + Intronic
1077558914 11:3244131-3244153 CGTGACATGCTTGAACTTTCTGG + Intergenic
1083588068 11:63874794-63874816 CTTGACATGGTAGAGCTGTCAGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1092294673 12:7189022-7189044 CGTTACCAGCTCGAGGTCTCAGG + Intronic
1096113167 12:49040758-49040780 CCTGAGATGCCCGAGGGGTCAGG + Exonic
1108036010 13:46291216-46291238 CTTCTCATGCTCCAGGTGTCAGG - Intergenic
1121107605 14:91291408-91291430 CGTGAGATGCTCCTGGGGTCAGG + Intronic
1121174109 14:91877599-91877621 CGGGACATGGACGTGGTGTCAGG - Exonic
1121939446 14:98055762-98055784 GGTGGCATGATTGAGGTGTCAGG - Intergenic
1132894850 16:2223876-2223898 CGCGAGATCCGCGAGGTGTCTGG - Intronic
1137069861 16:35894571-35894593 CTTGACTTGCTCCAGGTTTCAGG - Intergenic
1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG + Intronic
1138891541 16:61149779-61149801 TGTGGCATGCTGGAGGTGTGAGG + Intergenic
1141696340 16:85621554-85621576 GGTGACAGGCTCCAGGGGTCTGG - Intronic
1141800629 16:86306045-86306067 GGTGATATGCTCGAAGTCTCAGG - Intergenic
1148820049 17:50354983-50355005 CGGGACCTGCTAGAGGTGCCTGG + Exonic
936660777 2:114541237-114541259 CCTGACATACTCGGGGGGTCTGG + Intronic
943258243 2:185625600-185625622 CCTGTCATGCCCCAGGTGTCAGG + Intergenic
1184002070 22:41682383-41682405 CGTGGTATCCTCGCGGTGTCCGG - Exonic
956090499 3:65661558-65661580 AGTGGCTTGCTCAAGGTGTCTGG - Intronic
985867033 5:2522063-2522085 CCTGAAATGCTAGAGATGTCTGG - Intergenic
986772749 5:10988534-10988556 CGTGACCTGCCCAAGGTGTGTGG + Intronic
994541269 5:101101447-101101469 CGTGACATGCTAGAGCTAGCTGG + Intergenic
1001286230 5:170425951-170425973 CGTGGCATGCTCTAGGACTCAGG + Intronic
1001834220 5:174817380-174817402 CCTGGCATACTCTAGGTGTCTGG - Intergenic
1005758031 6:28943176-28943198 CGGGAAAGGCTCTAGGTGTCTGG + Intergenic
1029605674 7:101598258-101598280 CGTGAAATCCTAGAAGTGTCTGG - Intergenic
1035694428 8:1584376-1584398 TGTGGCATGCACGAGGAGTCTGG - Intronic
1046302279 8:112311576-112311598 CCTAACATGGTAGAGGTGTCTGG - Intronic
1050758891 9:9041783-9041805 AGTGACATGCTCGAGCTGGAAGG + Intronic
1190057722 X:47191349-47191371 CGTGGCATTGTGGAGGTGTCAGG + Intronic
1191852370 X:65594953-65594975 CATTACATGCTGGAGGTGTAGGG - Intronic
1197870389 X:131058236-131058258 CGTGACATGCTCGAGGTGTCCGG + Exonic
1202276372 Y:23124879-23124901 CATGAAATGCTGGAGGTGGCAGG - Intergenic
1202289656 Y:23295811-23295833 CATGAAATGCTGGAGGTGGCAGG + Intergenic
1202429366 Y:24758604-24758626 CATGAAATGCTGGAGGTGGCAGG - Intergenic
1202441425 Y:24911486-24911508 CATGAAATGCTGGAGGTGGCAGG + Intergenic