ID: 1197871079

View in Genome Browser
Species Human (GRCh38)
Location X:131063445-131063467
Sequence GATTTCCACAGAAGCATACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 177}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197871069_1197871079 12 Left 1197871069 X:131063410-131063432 CCCTCCCATTTCCCTTTTCAAAG 0: 1
1: 0
2: 2
3: 44
4: 499
Right 1197871079 X:131063445-131063467 GATTTCCACAGAAGCATACAGGG 0: 1
1: 0
2: 2
3: 11
4: 177
1197871070_1197871079 11 Left 1197871070 X:131063411-131063433 CCTCCCATTTCCCTTTTCAAAGC 0: 1
1: 0
2: 4
3: 38
4: 355
Right 1197871079 X:131063445-131063467 GATTTCCACAGAAGCATACAGGG 0: 1
1: 0
2: 2
3: 11
4: 177
1197871068_1197871079 13 Left 1197871068 X:131063409-131063431 CCCCTCCCATTTCCCTTTTCAAA 0: 1
1: 0
2: 9
3: 67
4: 619
Right 1197871079 X:131063445-131063467 GATTTCCACAGAAGCATACAGGG 0: 1
1: 0
2: 2
3: 11
4: 177
1197871074_1197871079 1 Left 1197871074 X:131063421-131063443 CCCTTTTCAAAGCTAAGGCTCCA 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1197871079 X:131063445-131063467 GATTTCCACAGAAGCATACAGGG 0: 1
1: 0
2: 2
3: 11
4: 177
1197871075_1197871079 0 Left 1197871075 X:131063422-131063444 CCTTTTCAAAGCTAAGGCTCCAG 0: 1
1: 0
2: 3
3: 21
4: 175
Right 1197871079 X:131063445-131063467 GATTTCCACAGAAGCATACAGGG 0: 1
1: 0
2: 2
3: 11
4: 177
1197871071_1197871079 8 Left 1197871071 X:131063414-131063436 CCCATTTCCCTTTTCAAAGCTAA 0: 1
1: 0
2: 1
3: 37
4: 396
Right 1197871079 X:131063445-131063467 GATTTCCACAGAAGCATACAGGG 0: 1
1: 0
2: 2
3: 11
4: 177
1197871067_1197871079 24 Left 1197871067 X:131063398-131063420 CCTAATTGCTACCCCTCCCATTT 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1197871079 X:131063445-131063467 GATTTCCACAGAAGCATACAGGG 0: 1
1: 0
2: 2
3: 11
4: 177
1197871072_1197871079 7 Left 1197871072 X:131063415-131063437 CCATTTCCCTTTTCAAAGCTAAG 0: 1
1: 0
2: 2
3: 42
4: 400
Right 1197871079 X:131063445-131063467 GATTTCCACAGAAGCATACAGGG 0: 1
1: 0
2: 2
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197871079 Original CRISPR GATTTCCACAGAAGCATACA GGG Intronic
902997101 1:20234724-20234746 CAGTTCCACAGAAGCATTCATGG + Intergenic
903354516 1:22738167-22738189 GATTTATACAGAAGCACAGATGG + Intronic
903836755 1:26208776-26208798 GATTTCAACAGATGTATACCAGG - Intergenic
907312312 1:53545949-53545971 ATTTTCCACATAAGAATACAGGG + Intronic
908167817 1:61475759-61475781 TATTCCTACAAAAGCATACATGG + Intergenic
908565016 1:65345521-65345543 GATTTGCAAACAAGCATACCTGG - Intronic
908594039 1:65667006-65667028 GATATCAACACAAGCCTACAAGG - Intergenic
911698573 1:100923822-100923844 GATTTCCAAAGAAGAAGAAAAGG - Intronic
912757446 1:112336350-112336372 CATTTGCACAGAAACAAACAGGG + Intergenic
916826159 1:168443989-168444011 GATTAACACAGAAGAATAAAGGG + Intergenic
919120165 1:193329906-193329928 TATTTCAACAGAAGCAGAAAAGG - Intergenic
921653599 1:217707582-217707604 GATTTCCACACAATAATACTGGG + Intronic
922679729 1:227583213-227583235 GATGTCTACTGAATCATACATGG - Intronic
924373463 1:243381840-243381862 GATTACCACAGGAGCACATAGGG + Intronic
924868714 1:248016285-248016307 GATTTACACAGGAGATTACATGG + Intronic
1063850126 10:10178880-10178902 GATTTCTAAGGAAGCAAACAAGG - Intergenic
1064239085 10:13608546-13608568 GATTTCAACCAGAGCATACAAGG - Intronic
1065294029 10:24257954-24257976 GATGGCCACAGAAGCAGAGAGGG + Intronic
1068318690 10:55381710-55381732 GATATACACAGAAGCACAGATGG + Intronic
1069146070 10:64892907-64892929 GATGTCCAAGGAAGCATCCAGGG - Intergenic
1073693910 10:105844223-105844245 GATTTTCACTGAATCATAAACGG + Intergenic
1073863555 10:107774492-107774514 TATTTCCACAGAAGCAGAAAAGG + Intergenic
1074391729 10:113063661-113063683 GGTTTCAACAGAAGCATGCCAGG - Intronic
1074926964 10:118083391-118083413 GATAACCAAAGAAGCAAACACGG - Intergenic
1075339777 10:121637194-121637216 CTTTTTCACAGAAGAATACATGG + Intergenic
1078855539 11:15203884-15203906 GAATTTCACAGAAGCTTTCATGG - Intronic
1080766215 11:35299691-35299713 TATCTCCACAGAACCAAACATGG - Intronic
1087557042 11:99734049-99734071 GTCTTCCAAAGAAGTATACATGG + Intronic
1088695811 11:112365031-112365053 GAATTCCACACAAGCTGACATGG + Intergenic
1089718790 11:120392077-120392099 GAGATCCACAGAAGTAGACAGGG - Intronic
1090998896 11:131891701-131891723 GTTGTCCACAGAAAAATACATGG - Intronic
1093590804 12:20899868-20899890 GTTTCCCACAGAAGCATTTAGGG - Intronic
1095699176 12:45173705-45173727 CATTCCCACAGAAGCATTCTTGG - Intergenic
1095958956 12:47821654-47821676 GATTTCAACAGAAGGAGAAAGGG - Intronic
1096754718 12:53789573-53789595 GTTTTCTACAAAAGCATGCAGGG - Intergenic
1096935607 12:55270390-55270412 TATTCCCACAGAAGCTTAAAAGG + Intergenic
1098474444 12:70883986-70884008 GATATCCACAGACCCATGCATGG - Intronic
1101296495 12:103428876-103428898 GATTTCAATAGATGCAGACAAGG + Intronic
1102565424 12:113794443-113794465 AATTTCCACAGAAGCAAACATGG - Intergenic
1102831964 12:116010841-116010863 GGTTTGCAGGGAAGCATACATGG + Intronic
1104001197 12:124861731-124861753 GATATCCACAGAAGGATGCTGGG + Intronic
1105253771 13:18725904-18725926 GAGTTCCACAGAAATATATATGG - Intergenic
1106744776 13:32689622-32689644 AAGTTCCACAGAATCACACAAGG + Intronic
1106978510 13:35251034-35251056 GGGTTCCACAGAAGAAAACATGG + Intronic
1110910890 13:80961469-80961491 CATTTCCACCGAAATATACAAGG + Intergenic
1112121652 13:96418944-96418966 GACTTCCAAAGATGCAGACATGG - Intronic
1113561143 13:111282771-111282793 GAATTTCACAAAAGCACACAGGG - Intronic
1113752619 13:112786831-112786853 GGTCTCCACAGAAGTTTACACGG - Intronic
1115414659 14:33117615-33117637 GATTTCCACACTAGCATCTAAGG - Intronic
1116168530 14:41366602-41366624 GATTCTCAAAGAAGCATTCAAGG + Intergenic
1116247995 14:42442320-42442342 GTTTTTCACAGAAGAATACATGG + Intergenic
1117024104 14:51602269-51602291 GATTTACACACACACATACACGG - Intronic
1118585352 14:67347456-67347478 GTTAAACACAGAAGCATACATGG + Intronic
1122378043 14:101280341-101280363 GAAGTCCACAGCAGCATACAGGG - Intergenic
1124797684 15:32798304-32798326 GATGTCCGCAGCAGGATACAGGG + Intronic
1125538103 15:40454359-40454381 CATCTCCACAGAAGCAGAAAGGG - Intronic
1125613876 15:40992540-40992562 GATTTCCCCAGAACCATTTATGG - Intronic
1129135442 15:73545579-73545601 AATTTTTACAGAAGCAAACATGG + Intronic
1132475608 16:135778-135800 GAACTACACAGAAGCAAACAGGG + Intronic
1139142156 16:64279503-64279525 GATATTCAAAGAAGCAGACATGG - Intergenic
1139774293 16:69305212-69305234 AATTTGCATAGCAGCATACAAGG - Exonic
1140348868 16:74242522-74242544 AATTTCCATAGATGCAGACATGG - Intergenic
1141148379 16:81547644-81547666 GATCTCCTCAGAAGCCTGCAGGG + Intronic
1143789674 17:9284195-9284217 AATTTCCTCAGCAGGATACAGGG + Intronic
1143841657 17:9737053-9737075 GATTCCCACAGAATAATACTGGG - Intergenic
1146528310 17:33585539-33585561 GATTACCACAGAGGCAAGCAGGG + Intronic
1146688751 17:34858686-34858708 GATTTCTAGAAAAGCATACTTGG + Intergenic
1149208399 17:54276019-54276041 GACTTCCTCAGAAACAGACATGG + Intergenic
1154343833 18:13526209-13526231 GATTTCCGCAGGAGCCTACTAGG + Intronic
1157561170 18:48647659-48647681 TATTTCCTCAGAACCTTACATGG + Intronic
1157951555 18:52043842-52043864 GATATCAGCAGAAGTATACAAGG + Intergenic
1162351661 19:10154088-10154110 GATGTCCACAGAGGCATGCTTGG - Intronic
1163914880 19:20232336-20232358 CATTAGCTCAGAAGCATACATGG - Intergenic
1164262462 19:23579960-23579982 GATTTCTACAAAAACAAACATGG + Intronic
1164562806 19:29304504-29304526 GATTTCCACTGAAGGACACATGG + Intergenic
1167230236 19:48278336-48278358 GATGACCACTGAAGGATACAGGG - Intronic
1168210308 19:54885283-54885305 GATTTTCACAGATCCATCCAAGG - Exonic
926737841 2:16087570-16087592 GATTTACACAGCAGCAGGCAAGG + Intergenic
926848621 2:17169983-17170005 GACTTAGACAGAAGCAGACAGGG - Intergenic
927396730 2:22660592-22660614 GATTTCCACAATAGCATACAAGG - Intergenic
927615677 2:24592276-24592298 GCTTTACACAGAAGCTTACTTGG - Intronic
928264322 2:29798661-29798683 GATGTCCATGGAAGCATAGAGGG - Intronic
928357900 2:30637461-30637483 AATTCCCACTGTAGCATACAAGG + Intronic
928695250 2:33842462-33842484 GATTTATACAGAAGCACAGATGG - Intergenic
928829198 2:35458647-35458669 TATTTCCACCGAAGTATAGAAGG - Intergenic
931025407 2:58108615-58108637 GACTTCCACAGATGGAGACAGGG - Intronic
931341639 2:61407535-61407557 TATTTCCACATGATCATACAGGG - Intronic
931419460 2:62113047-62113069 GATGTCTACAAAAGCATATATGG + Intronic
932229301 2:70069342-70069364 GGTTCCCACAGAAGCATCCCAGG + Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
933421985 2:82060127-82060149 GATCTGCAAAGAAGAATACATGG - Intergenic
936984084 2:118291480-118291502 CTTTTCCACAGGAGCATCCAGGG + Intergenic
938924855 2:136029824-136029846 GATTATTACAGAAGCATAGAAGG + Intergenic
939290737 2:140191991-140192013 GATTTCCAAAGAAGAATGCTAGG + Intergenic
939337310 2:140846773-140846795 GGTTTCCACAGAGTCATTCATGG + Intronic
940118343 2:150235415-150235437 AATTTCCTCAGCAGCATAGATGG + Intergenic
940336468 2:152533309-152533331 GATAAATACAGAAGCATACATGG - Intronic
941315828 2:163991296-163991318 GAGGGCCACAGGAGCATACAAGG - Intergenic
942124612 2:172810888-172810910 GGTTTCCCCAGAAGCAGACCTGG + Intronic
943307493 2:186282260-186282282 CATTTACACTGAAGCTTACATGG - Intergenic
947652764 2:231801281-231801303 TATTTCCACAAAAGCCTAAATGG - Intronic
1169602715 20:7280319-7280341 GGTTTACACAGAAGCACACAAGG - Intergenic
1170512332 20:17091028-17091050 AATTTCCATAGAACAATACAAGG - Intergenic
1170953571 20:20957897-20957919 GTTTTCCACAGGAGTAAACACGG - Intergenic
1172805513 20:37609007-37609029 GGGTTCCCCAGAAGCAGACAAGG - Intergenic
1172827913 20:37805966-37805988 GCTTTCCTCAGAAACCTACAAGG + Intronic
1176839282 21:13825895-13825917 GAATTCCACAGAAATATATATGG - Intergenic
949598112 3:5568946-5568968 GGTTTGCACAGAAGTATACCTGG - Intergenic
949676605 3:6462144-6462166 GTTTTCCACAAAAACTTACAAGG - Intergenic
951230316 3:20171150-20171172 GATTTTCACAACAGGATACAAGG + Exonic
952523831 3:34189059-34189081 GAGTTCCCCAGAAGCAGAGATGG + Intergenic
954888952 3:53905271-53905293 GATATGCAAAGAAGAATACATGG + Intergenic
956070626 3:65446517-65446539 AATTTCCAGAGAAGCAAATAAGG + Intronic
959480043 3:106860696-106860718 AAATTTCAAAGAAGCATACATGG - Intergenic
964129675 3:153272816-153272838 AAATTCCTGAGAAGCATACAGGG + Intergenic
964521597 3:157575199-157575221 GATTTCAACAGAAGCAAAAAAGG + Intronic
966199468 3:177346823-177346845 AATTTCCAGAGTAGAATACATGG - Intergenic
966307907 3:178557519-178557541 GATTTCCACAGAGATAAACAAGG + Intronic
971657404 4:29367181-29367203 GAGTTCAAGAGAAGCATAAATGG - Intergenic
972165936 4:36283958-36283980 GATTTCTACACACACATACATGG - Intronic
973930154 4:55784285-55784307 AATTTTCACAGAAGCAGAAAAGG + Intergenic
974293681 4:59967093-59967115 GATGACCACAGAAACATAAAAGG + Intergenic
975908444 4:79243117-79243139 GGCTTCCTCAGATGCATACATGG + Intronic
976044430 4:80928914-80928936 GATTTGCACACAAACATACAAGG - Intronic
977735309 4:100408116-100408138 GAATTCAACAAAACCATACAAGG - Intronic
980372186 4:131889864-131889886 GTTGTCCAGAGATGCATACATGG - Intergenic
980666064 4:135937211-135937233 GTTTTCAACAAAAGCTTACAAGG + Intergenic
983524187 4:168743837-168743859 GATGTCCACAGATAGATACATGG - Intronic
984265219 4:177490194-177490216 GGTTTCCACAGTAGCATTCTAGG + Intergenic
987525057 5:19037306-19037328 AATTTCCACTGAAACATAAATGG - Intergenic
987539603 5:19237310-19237332 GGTTTACACAGAACCATCCAGGG - Intergenic
987599237 5:20043859-20043881 GATTTCCATAGAAACATTAAAGG - Intronic
988275532 5:29077264-29077286 GATTTCCCCAGAGTCATATAAGG + Intergenic
988450680 5:31339831-31339853 GCTTTGCAAAGAAGGATACATGG - Intergenic
989073254 5:37534039-37534061 AATTTCCACAGGAACATACCAGG - Intronic
989780626 5:45260895-45260917 TTTTTCCCCAGAAGCATGCAGGG + Exonic
991522077 5:67511677-67511699 TATTTCCACAGATGCAGAAAAGG + Intergenic
992070264 5:73141814-73141836 ATTTTCCACAGAAGGATTCAGGG - Intergenic
993698109 5:91086011-91086033 GATTTCTACAGAAGAATTGAAGG - Intronic
993774358 5:91972582-91972604 GAATCCCTCAGAAGCATCCAGGG - Intergenic
994303276 5:98172346-98172368 GATTACCACAGAAGTACAGATGG - Intergenic
998682606 5:144487039-144487061 GCTTTCCACAAAAGAATTCATGG - Intergenic
998960431 5:147480587-147480609 GTTTTCCACAGAAGTTTAAATGG + Intronic
999210296 5:149882339-149882361 CATTTCCACAGAAGCATCTGGGG + Intronic
1004033122 6:11892438-11892460 AAATTCCTCAGAAGCACACATGG - Intergenic
1005230746 6:23699165-23699187 GTTTGCAACAGAAGCAGACAAGG + Intergenic
1005284343 6:24308989-24309011 GATCTGCACAGAAGTATAAAAGG + Intronic
1005685922 6:28252820-28252842 GATTGCCAGAGAAGCAGCCATGG - Intergenic
1009527064 6:64760789-64760811 GGTTCCCACCGAAGCATCCATGG - Intronic
1010405830 6:75504841-75504863 GAATTCCACACAGGCAAACATGG - Intergenic
1011501123 6:87991185-87991207 CATTTTCAAAGAAGCATTCAGGG - Intergenic
1011509773 6:88087900-88087922 GCTTTACACAGAAGCATCCCTGG + Intergenic
1011892533 6:92183461-92183483 GATCTCTGCAAAAGCATACAAGG + Intergenic
1012403140 6:98861449-98861471 GCATTCCCCAGAAACATACAGGG - Intergenic
1016502916 6:144742570-144742592 GATTTTCACATAAGCAAACCAGG - Intronic
1018519194 6:164626109-164626131 GATTTCCCCAAAAGAATAAAAGG + Intergenic
1022402663 7:30055290-30055312 CATTCCCACAGAAGCATTCTTGG + Exonic
1024600986 7:50981672-50981694 GATTTCCTCAACAGCTTACAAGG + Intergenic
1025029347 7:55544234-55544256 GATTAACACAGAAGCATGCTGGG - Intronic
1025726084 7:64062507-64062529 GATTTCCACTGAAGAGTCCATGG + Intronic
1026112837 7:67471857-67471879 GATTTATACAGAAACATACTCGG + Intergenic
1029403393 7:100358756-100358778 GATTTCCACAGAGCCACCCATGG - Exonic
1029405971 7:100374110-100374132 GATTTCCACAGAGCCACCCATGG - Exonic
1031360050 7:120838395-120838417 AATTTCCATAGGAGCTTACAGGG + Intronic
1034717297 7:153255523-153255545 GATTTCAGCAGCAGGATACAAGG + Intergenic
1035374563 7:158399327-158399349 TATTCCCACAGAAGCAGACCTGG + Intronic
1035912286 8:3580699-3580721 GATTTAGACAGAAGAACACACGG - Intronic
1038384289 8:27127304-27127326 AATTTCCAGAGAAGCCTACATGG + Intergenic
1045624534 8:104027710-104027732 GATTTTCATAGTAGCATACTGGG - Intronic
1046042686 8:108925698-108925720 GTTTCCCACAGAATTATACATGG - Intergenic
1047276304 8:123408280-123408302 GATTTCCACAGAAGGAGGCTGGG - Intronic
1048864355 8:138748639-138748661 GAGATCCAGAGAAGCAAACAGGG - Intronic
1051208717 9:14718475-14718497 GAGTTACACAGATGCACACATGG - Intergenic
1051858112 9:21592934-21592956 GATTTCCACAGAATCTCAAAAGG - Intergenic
1052493156 9:29192453-29192475 GATTTCCACAGAAGTATTGATGG + Intergenic
1055140008 9:72865908-72865930 CATTTCCAAAGCAGCACACATGG + Intergenic
1059160852 9:112034046-112034068 CATCTCTACAGAAGCCTACAAGG + Intergenic
1059747691 9:117219004-117219026 GATTTGCACAGCAGCCTATAGGG - Intronic
1059860451 9:118454827-118454849 GATATCCATAGAAGAAAACAGGG - Intergenic
1188096128 X:26024957-26024979 GATTTCTACAAAATCATCCATGG + Intergenic
1191813569 X:65218275-65218297 AATTACCACACAAACATACAAGG + Intergenic
1192270895 X:69578286-69578308 GATTTCAACAGCAGCAAACAAGG - Intergenic
1193008435 X:76647127-76647149 GGTTTCAAGAGAAGCACACATGG - Intergenic
1194601014 X:95921916-95921938 AAATTCCACAGAAGCAAACTGGG - Intergenic
1195684238 X:107571102-107571124 CATTACCACAGAAGCACATAAGG + Intronic
1197279163 X:124515104-124515126 GATCTCAACAGATGCATAAATGG + Intronic
1197871079 X:131063445-131063467 GATTTCCACAGAAGCATACAGGG + Intronic
1198417619 X:136436316-136436338 CATTTCTACATAACCATACATGG - Intergenic
1198627516 X:138594398-138594420 GATTTCCACATCTGCATAAATGG - Intergenic
1201777194 Y:17679076-17679098 GTTTTCCACAGGAGCCTCCATGG + Intergenic
1201824363 Y:18226916-18226938 GTTTTCCACAGGAGCCTCCATGG - Intergenic