ID: 1197872225

View in Genome Browser
Species Human (GRCh38)
Location X:131071241-131071263
Sequence AGGGAGCAGCAGTTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 387}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197872225_1197872237 23 Left 1197872225 X:131071241-131071263 CCAGCCTCAAACTGCTGCTCCCT 0: 1
1: 0
2: 4
3: 34
4: 387
Right 1197872237 X:131071287-131071309 TGGTGCTCTAGAATGTATAAAGG 0: 1
1: 0
2: 2
3: 7
4: 91
1197872225_1197872231 3 Left 1197872225 X:131071241-131071263 CCAGCCTCAAACTGCTGCTCCCT 0: 1
1: 0
2: 4
3: 34
4: 387
Right 1197872231 X:131071267-131071289 TTTCTCCCCCTCTACTTACCTGG 0: 1
1: 0
2: 1
3: 22
4: 234
1197872225_1197872238 24 Left 1197872225 X:131071241-131071263 CCAGCCTCAAACTGCTGCTCCCT 0: 1
1: 0
2: 4
3: 34
4: 387
Right 1197872238 X:131071288-131071310 GGTGCTCTAGAATGTATAAAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1197872225_1197872239 25 Left 1197872225 X:131071241-131071263 CCAGCCTCAAACTGCTGCTCCCT 0: 1
1: 0
2: 4
3: 34
4: 387
Right 1197872239 X:131071289-131071311 GTGCTCTAGAATGTATAAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197872225 Original CRISPR AGGGAGCAGCAGTTTGAGGC TGG (reversed) Intronic
901245216 1:7725024-7725046 TGGAAGCAGCAGTTTCAGCCTGG - Intronic
901820174 1:11823929-11823951 AGACATCAGCTGTTTGAGGCTGG - Intronic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
903790035 1:25886535-25886557 AGGGAGCAGCACATGGAGGGTGG - Intronic
904687919 1:32274142-32274164 AGGGAGCACCGGTTTGGAGCTGG + Intronic
904920890 1:34007145-34007167 AGGGAGCTTCAGGTCGAGGCGGG - Intronic
905015769 1:34777363-34777385 AGGGAGCAGAAATTTAGGGCAGG + Intronic
905226683 1:36483217-36483239 GGGGAGCATCACTTGGAGGCAGG + Exonic
905625731 1:39489863-39489885 AGGGCCCTGCAGTTGGAGGCAGG - Intergenic
906320745 1:44813818-44813840 CGGGAGCTGTAGTTTGGGGCAGG - Exonic
906745218 1:48216706-48216728 TGGGAGCAGCCGTTTGAAGAGGG + Intergenic
908236529 1:62152362-62152384 AAGGAGCAGCAGTCTGAGTGCGG + Intronic
908553533 1:65233861-65233883 AGGCCACAGCAGTGTGAGGCAGG + Intergenic
909021868 1:70440677-70440699 AGGCAGTAGCATTTTGAGGCAGG + Intergenic
909252924 1:73381311-73381333 AGGGAGCAGGAGAGTGAGGTGGG - Intergenic
909866230 1:80675635-80675657 AGGGAATAGGAGTTTGAGTCGGG + Intergenic
910028668 1:82689244-82689266 AGGAAGCAGCGGTATGGGGCTGG - Intergenic
910150034 1:84131819-84131841 TGGGAGCAGCAGTCTTAGGGAGG + Intronic
911719840 1:101178549-101178571 AGAGTCCAGGAGTTTGAGGCCGG - Intergenic
912302050 1:108528197-108528219 AAGAAGCAGCAGCTTGATGCTGG - Intergenic
912557549 1:110527185-110527207 AGGGAGCAGCAGCTGGATACAGG - Intergenic
912795621 1:112691721-112691743 GGGGAGCAGCTGCCTGAGGCGGG - Exonic
913050707 1:115114486-115114508 AGCCAGCAGCAGTGTGAGGCTGG + Intergenic
913223275 1:116676544-116676566 AGGGAGCAAGAGTTAGAGGTGGG + Intergenic
914045265 1:144086130-144086152 AGGAAGCAGATGTGTGAGGCTGG + Intergenic
914132845 1:144874556-144874578 AGGAAGCAGATGTGTGAGGCTGG - Intergenic
915163166 1:153933615-153933637 AGTGAGCAGCTGTTGGAGGCGGG + Exonic
915511060 1:156387379-156387401 AGGGTGCAGGGGCTTGAGGCAGG - Intergenic
916105221 1:161424682-161424704 AGGGAGGAGCAGTCAGAGCCTGG + Intergenic
916128821 1:161593587-161593609 AGGGAGCAGCGGTGGGAGGATGG + Intronic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
916582205 1:166119041-166119063 TTGGAGTAGCAGTTTGAAGCCGG - Intronic
917645308 1:177023722-177023744 AGGGATCAGCAGACAGAGGCTGG + Intronic
918155006 1:181836120-181836142 AGAGACCATCAGTTTGGGGCAGG - Intergenic
920265314 1:204717138-204717160 TGGGAGCAGCAGGTTGAGGGAGG + Intergenic
920705989 1:208251009-208251031 AGGAAACAGAAGTTGGAGGCTGG - Intergenic
921861401 1:220046101-220046123 AGGGAGGCGCAGTGTGAGCCCGG - Intronic
921990566 1:221361511-221361533 AGGAAGGGGCAGCTTGAGGCCGG - Intergenic
922782502 1:228264154-228264176 AGGGAGGTGCAGGCTGAGGCGGG + Exonic
922783024 1:228268568-228268590 AGGGAGGTGCAGGCTGAGGCGGG + Exonic
922783524 1:228271984-228272006 AGGGAGGTGCAGGCTGAGGCAGG + Exonic
922808033 1:228400653-228400675 AGGGAGCAGCAGTGTCAGTCAGG + Intronic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
1062838658 10:652537-652559 ACGGAGCTGCAGTGGGAGGCGGG + Exonic
1063707883 10:8448767-8448789 TGGGAGGAGCAGGTTGAGGTGGG - Intergenic
1064352866 10:14592762-14592784 AGGGCGCAGGAGTTAGAAGCAGG - Intronic
1065542959 10:26788614-26788636 AGATACCAGCAGTTTGAGGCCGG + Intronic
1066957376 10:42185823-42185845 AGGAAGCAGATGTGTGAGGCTGG + Intergenic
1067081426 10:43214660-43214682 AGGGAAGAGCAGTATAAGGCAGG + Intronic
1069807784 10:71136763-71136785 AGGCAGCAGAAGTGTGAAGCAGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071437968 10:85664391-85664413 AGGGAAGAGCATTTTGAGGTAGG - Intronic
1072940640 10:99760555-99760577 AGGGAGCAGCATCCTGAGGCAGG + Intergenic
1072997013 10:100254342-100254364 AGGAAGTGGCAGTTTGAGGAAGG + Intronic
1073096312 10:100982213-100982235 AGGGAGCAGCAGGCAGAGGGAGG + Intronic
1073241672 10:102063140-102063162 AAGGAGGAGCAGTTTGGGGCAGG + Intergenic
1074097192 10:110324393-110324415 AGCTACCAGAAGTTTGAGGCAGG - Intergenic
1075092017 10:119449080-119449102 TGGGAGCAGCAGTGTGCTGCAGG + Intronic
1075233142 10:120701155-120701177 TGGGAGCAGCACTTTGGCGCTGG - Intergenic
1076434343 10:130429897-130429919 AGGGAGCATGAGCTGGAGGCTGG + Intergenic
1076872732 10:133201641-133201663 AGAGCGCAGCAGCCTGAGGCTGG + Exonic
1077119393 11:899824-899846 AGCGAGCAGCAGCCTGAGCCTGG + Intronic
1078302365 11:10145149-10145171 ATGATGCAACAGTTTGAGGCTGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1079099286 11:17530910-17530932 AGGAGGCAGCAGTTGGAAGCAGG + Intronic
1084004563 11:66316168-66316190 TGCGAGCAGCAGTGTGAGCCCGG - Exonic
1084566602 11:69932166-69932188 AGGGAGCAGCAGTCTGCTGCTGG - Intergenic
1086825414 11:91489799-91489821 AAGGACCATCAGGTTGAGGCAGG + Intergenic
1086970232 11:93073511-93073533 AGGTAGCAGCAGGCAGAGGCAGG - Intergenic
1088825916 11:113494394-113494416 TGAGACCAGGAGTTTGAGGCTGG - Intergenic
1089001695 11:115057480-115057502 AGGGAGCAGAGACTTGAGGCAGG - Intergenic
1089538568 11:119175379-119175401 AGGAAGCAGCAGTTTCCTGCTGG - Intronic
1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG + Intergenic
1089774696 11:120828076-120828098 GGGGAGCAGCAGTGCCAGGCAGG - Intronic
1089968061 11:122670297-122670319 TGGCAGCAGCAGGTGGAGGCTGG - Intronic
1090779068 11:129990697-129990719 TGGGAGGATCACTTTGAGGCCGG - Intronic
1091035935 11:132233451-132233473 AGGGATCAGCAGATTAAGGCAGG + Intronic
1092173919 12:6390295-6390317 AGGGAGCCGCAGTTGGAACCCGG + Exonic
1093921266 12:24862372-24862394 AGGGAGGGGCAGTGTCAGGCAGG - Intronic
1094474016 12:30827581-30827603 AGGTACCAGCAGTTGGAGACAGG + Intergenic
1094486239 12:30927744-30927766 GGAAAGCAGCAGTTAGAGGCTGG + Intronic
1095154377 12:38834369-38834391 GGGGAGAAGGAGATTGAGGCAGG - Intronic
1095292726 12:40493815-40493837 AAGGAGCAGCAGTTTGCGGTGGG + Intronic
1096254941 12:50057265-50057287 AGGAAGCAGCAGCAAGAGGCAGG + Intergenic
1097610895 12:61818578-61818600 ATGGAGCACCACTCTGAGGCAGG + Intronic
1098805901 12:75020034-75020056 AGGCTGCAGCAGCTTGTGGCTGG + Intergenic
1098956310 12:76693270-76693292 AGGGACCAGCAGGTTGATCCAGG + Intergenic
1099152208 12:79128298-79128320 TGGGAGCACCTGTTTGAGCCAGG + Intronic
1101031647 12:100666780-100666802 AAGGAGCAGCAGTTGGGGTCAGG - Intergenic
1101365217 12:104064500-104064522 AGGGAGCAGCCGGTTGAGGCGGG + Exonic
1102391235 12:112550405-112550427 AAGGAACAGCACTTTGAGGTAGG - Intergenic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1103711857 12:122918537-122918559 TGGGCCCAGGAGTTTGAGGCTGG - Intergenic
1104119274 12:125783575-125783597 AGGGATGAGCAGTTTGAAGTGGG - Intergenic
1104187759 12:126448987-126449009 AGGGAGCAGCTGTCTGAATCTGG - Intergenic
1104467970 12:129005497-129005519 AGGGAGGAGCAGTTTGGAGGAGG + Intergenic
1104468006 12:129005670-129005692 AGGGAGGAGCAGTTTGGAGGAGG + Intergenic
1104468035 12:129005815-129005837 AGGGAGGAGCAGTTTGGAGGAGG + Intergenic
1105480685 13:20773112-20773134 AGGAAGGAACTGTTTGAGGCAGG - Intronic
1106803817 13:33285592-33285614 AGGTAGTAGCAGCCTGAGGCTGG + Exonic
1107458006 13:40572898-40572920 AGGGAGCAGCAGTTTGTGAGGGG - Intronic
1112986946 13:105462334-105462356 AGGAAGGAATAGTTTGAGGCTGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1115341610 14:32298689-32298711 AAGAAGCAGCAGTTTGGGGCTGG + Intergenic
1116254572 14:42534891-42534913 ATGGAGCAGCAATTTAAGGTTGG - Intergenic
1116326600 14:43538623-43538645 AAGGACCAGCAGGTTGAGACAGG - Intergenic
1116849361 14:49893104-49893126 TGGGAGGAGGAGTTGGAGGCCGG + Exonic
1117812991 14:59568196-59568218 AGGGAGCAGGGGTCTGAGGCTGG - Intronic
1118708537 14:68501569-68501591 GGTCAGCAGCACTTTGAGGCTGG + Intronic
1119525761 14:75321081-75321103 AGGGAGGAGCTGTTTCAGGCCGG + Intergenic
1119624472 14:76160204-76160226 AGGCAGCTACAGGTTGAGGCAGG - Intronic
1119891873 14:78189004-78189026 TGGGAGGAGCAGATTGGGGCAGG - Intergenic
1120826161 14:88957512-88957534 AGGGAGAAGTAGTTTGGGGGTGG - Intergenic
1121470083 14:94146058-94146080 AGGGAGCAACTGTGTGAGGTAGG + Intergenic
1122087534 14:99318014-99318036 AGCCAGCAGCAGTTTGAAGAAGG + Intergenic
1122370747 14:101227714-101227736 AGGGAGAAGCAGGTCGGGGCAGG + Intergenic
1122381856 14:101313555-101313577 AGGGAGAAGCAGGTCGGGGCAGG - Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1123826362 15:24086287-24086309 AAGGTGAAGCAGTTTGTGGCAGG - Intergenic
1124203980 15:27701840-27701862 CGGGAGCAGCAGCTTTGGGCAGG + Intergenic
1124360026 15:29029841-29029863 GGGGAGCAGTGGCTTGAGGCTGG + Intronic
1124371378 15:29106578-29106600 AGGGATCAGCAGTGTGAGAGGGG - Intronic
1124593013 15:31069947-31069969 AGGTATCTGCAGTTTGGGGCTGG + Intronic
1125695168 15:41630206-41630228 ACTGAGTAGGAGTTTGAGGCAGG - Intronic
1126753851 15:51905199-51905221 TGGTATCAGCAGATTGAGGCCGG + Intronic
1128904005 15:71451480-71451502 GGGGAGCAGCAGATGCAGGCAGG - Intronic
1129221695 15:74135041-74135063 TGGGAGCAGCAGTCTAGGGCTGG + Exonic
1129665294 15:77576226-77576248 AGGGAGGAGCAGGGGGAGGCTGG + Intergenic
1129689243 15:77703994-77704016 AGGGACAAGGAGTTTGAGTCCGG + Intronic
1130889048 15:88117869-88117891 AGGAAGCAGAAGCCTGAGGCTGG - Intronic
1131137996 15:89953046-89953068 AGGCGGCAGCAGTCAGAGGCTGG + Intergenic
1131459064 15:92605746-92605768 CGGCAGCAAAAGTTTGAGGCCGG + Intergenic
1133024489 16:2982043-2982065 ATGGAGCAGCAGTGTGGGGGAGG + Intergenic
1134557984 16:15182758-15182780 AGTGAGCAGGAATTTCAGGCAGG - Intergenic
1134874677 16:17687226-17687248 AGAATGCAGCAGTTTGAGGGAGG + Intergenic
1134918520 16:18094361-18094383 AGTGAGCAGGAATTTCAGGCAGG - Intergenic
1135800900 16:25494285-25494307 AAAGAGCAGCAGTCTAAGGCTGG - Intergenic
1136454426 16:30372222-30372244 AGGCAGCTGCTGTCTGAGGCAGG + Intronic
1137369935 16:47895870-47895892 AGGGAGCAGATGTGAGAGGCTGG + Intergenic
1138188691 16:54996904-54996926 AGGAAGCAGCAGTTTCCTGCAGG - Intergenic
1138214215 16:55188951-55188973 AGGGACCAGCAGGCTGAGACCGG + Intergenic
1138442802 16:57045413-57045435 AGGAAGCAGCAGTTTGAAAATGG - Intronic
1138542326 16:57695940-57695962 AGGGAGCAGCAGATAAAGGCTGG - Intronic
1139947058 16:70648680-70648702 GGAGAGCAGCAGATTGAGGTGGG + Intronic
1141089064 16:81117568-81117590 AGGGAGCAGCCCTGTGGGGCGGG - Intergenic
1142611641 17:1111738-1111760 AGGGAGCAGAGGGCTGAGGCTGG - Intronic
1142740203 17:1927430-1927452 AGGGAGATCAAGTTTGAGGCTGG + Intergenic
1144450077 17:15369847-15369869 AGGGAGCGGCAGGTGCAGGCAGG - Intergenic
1144950256 17:18990080-18990102 AGGGAGTAGCTGGTTGATGCAGG + Intronic
1146953503 17:36922503-36922525 AGGGAGCAGCTGTATGTGCCAGG - Intergenic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1148024625 17:44578056-44578078 AGGAGGAAGCAATTTGAGGCAGG - Intergenic
1148764696 17:50030429-50030451 AGGGAGCAGTGGTTTGAGGTTGG - Intergenic
1149632394 17:58137277-58137299 AAGTAACAGCAGTTTGAGGAAGG - Intergenic
1150145386 17:62764938-62764960 AGTCAGCAGCAGTTTGATTCAGG - Intronic
1150487279 17:65552511-65552533 AGGGACCAGAAGTCAGAGGCTGG + Intronic
1150997549 17:70336263-70336285 AGGCAGCATCAGAGTGAGGCAGG - Intergenic
1151502534 17:74500554-74500576 AGAGAGCAGCAGTTTTGGGGTGG + Intergenic
1152036600 17:77877144-77877166 AGGGAGGAGGAGGTTGAGGGAGG + Intergenic
1152331372 17:79675214-79675236 AGGGAGCAGCCCTCAGAGGCTGG + Intergenic
1152638378 17:81439450-81439472 GGGGAGCAGCAGTTGGACGGTGG + Intronic
1152814007 17:82397017-82397039 AGGGAGCAGCTGAGGGAGGCAGG + Intronic
1153343700 18:4003723-4003745 AGGGAGCAGCAAGTGGATGCTGG + Intronic
1153971039 18:10227355-10227377 TGGGGACAGCAGTTTGAAGCAGG - Intergenic
1154210905 18:12377550-12377572 AGCGAGCAGGAGCTGGAGGCGGG + Intergenic
1154307545 18:13241571-13241593 AGAGAGCAGCAGGTGAAGGCTGG + Intronic
1154493999 18:14942377-14942399 AGGAAGCGGCAGCCTGAGGCTGG + Intergenic
1155397477 18:25402126-25402148 AGAGAACAGCAGTGTGAGGTGGG - Intergenic
1155654202 18:28176640-28176662 AGGCAGCAGGAGGGTGAGGCAGG - Intronic
1156490214 18:37491647-37491669 AGGGAGAAGGAGTGTGTGGCAGG + Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1159041050 18:63322896-63322918 AGGGAACACCAGCCTGAGGCAGG + Intergenic
1160389274 18:78518068-78518090 GGGGAGCCGCAGTGTGAGGATGG + Intergenic
1160515423 18:79476797-79476819 ACGGAGCTGCAGTTTCAGCCTGG + Intronic
1161096768 19:2396597-2396619 GTGGACCAGCAGTTTGCGGCGGG + Exonic
1161297667 19:3527893-3527915 AGGGAGCATCAGTACGAGCCAGG + Intronic
1163002735 19:14378851-14378873 GGAGCCCAGCAGTTTGAGGCTGG + Intergenic
1163125807 19:15243594-15243616 AGGGAGTGCCAGTTTGAGGGAGG - Intronic
1163426445 19:17243467-17243489 AGGGAGCAGCAATTTTGGGTGGG - Intronic
1163718557 19:18886694-18886716 AGGAAGCCGCAGATGGAGGCTGG - Intronic
1163847179 19:19644158-19644180 AGGGAGCAGCCCTTTTAGGTAGG + Intergenic
1165585983 19:36916147-36916169 AGGGAGCAGCCGTTTCGGGTGGG - Intronic
1165710177 19:38005355-38005377 AGGGATCTGCAGGATGAGGCGGG - Intronic
1166186472 19:41142584-41142606 TGGGTGCAGGAGGTTGAGGCTGG - Intergenic
1166388077 19:42393111-42393133 AGGAAACAGCAGGTTGAGGAAGG - Intergenic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166695897 19:44851304-44851326 AGGGAGCAGGGGACTGAGGCTGG - Intronic
1167236703 19:48320076-48320098 AGGCAGCAGAAGTTTGAGTGGGG - Intronic
1168492436 19:56821961-56821983 TGGGAGCAGAAGGATGAGGCAGG - Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1202684823 1_KI270712v1_random:39534-39556 AGGAAGCAGATGTGTGAGGCTGG + Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925565848 2:5253311-5253333 GGGGAGCAACAGCTAGAGGCAGG + Intergenic
925745684 2:7041760-7041782 GGGCAGCAGCAATTTCAGGCAGG - Exonic
925948608 2:8890130-8890152 AGGGAGCAGCATTTGGAGAGAGG - Intronic
926142051 2:10373672-10373694 AGGGGGCAGCTGCTCGAGGCTGG - Intronic
927704314 2:25287543-25287565 TGTGAGCAGCTTTTTGAGGCAGG + Intronic
928234347 2:29526985-29527007 AGGGAGCAGGAGTCTGGGGTGGG + Intronic
928385481 2:30863942-30863964 ATGGAGCAGAAATATGAGGCAGG + Intergenic
929591472 2:43150377-43150399 AGGGTGCCTCAGCTTGAGGCAGG + Intergenic
929683212 2:44011963-44011985 TGGGAGAAGCAGTTTGAGTCAGG - Intergenic
930054039 2:47238447-47238469 AGGGATCAGCTGCTTGAGGTGGG + Intergenic
930931707 2:56892492-56892514 ATAGAGCAGTAGTTTCAGGCTGG - Intergenic
931650258 2:64462237-64462259 AGGGTGCAGCATTGGGAGGCTGG + Intergenic
932432495 2:71684371-71684393 TGGGAGGAGGAGCTTGAGGCAGG - Intronic
932886303 2:75552330-75552352 AGGGAGCAGCATTTATAGGAAGG - Intronic
933586175 2:84181703-84181725 AGGGAGCAGGAATTTGGGGGAGG - Intergenic
934246895 2:90315312-90315334 AGGAAGCAGATGTGTGAGGCTGG - Intergenic
934262431 2:91487291-91487313 AGGAAGCAGATGTGTGAGGCTGG + Intergenic
934305481 2:91818280-91818302 AGGAAGCAGATGTGTGAGGCTGG + Intergenic
934327775 2:92034468-92034490 AGGAAGCAGATGTGTGAGGCTGG - Intergenic
934466162 2:94264998-94265020 AGGAAGCAGATGTGTGAGGCTGG - Intergenic
934922840 2:98359765-98359787 AAGGAGCAGCTGTTTGTGGGGGG - Intronic
937119572 2:119432121-119432143 CGGGAGCAGCTATGTGAGGCAGG - Intronic
938091151 2:128435700-128435722 AGGGAGCAGGAGTGCGGGGCAGG + Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
944090509 2:195904700-195904722 AGGGAGCAGCAAGGTGTGGCAGG + Intronic
944235427 2:197437608-197437630 AGAGCCCAGGAGTTTGAGGCTGG - Intergenic
944245433 2:197525506-197525528 AGGGAGGATCACTTTGAGGTTGG + Intronic
944250422 2:197575425-197575447 AGGCAGAAGCAGTTTGCAGCAGG - Intronic
947912860 2:233812920-233812942 GGGGAGCAGGAGTTTAAAGCAGG + Intronic
948698650 2:239747133-239747155 TGGTAGCAGCAGGTGGAGGCTGG + Intergenic
948882470 2:240867171-240867193 TGGGAGCTGCAGTTGCAGGCCGG - Intergenic
1168765548 20:379923-379945 ATGGAGCAGGAAGTTGAGGCAGG + Intronic
1168898741 20:1342046-1342068 AAGGAGCAGAAGTTCCAGGCAGG - Intronic
1169022252 20:2339194-2339216 AGGGAGCTACAGTGTGAGCCAGG + Intronic
1169124312 20:3116108-3116130 AGGGAGCAGCAGTCCAAAGCTGG - Intronic
1169416877 20:5424840-5424862 GGGGAGCAGAACTTGGAGGCAGG + Intergenic
1170673188 20:18454070-18454092 AGGGAGCAGCACATGCAGGCAGG + Intronic
1170975472 20:21160177-21160199 AGAGAGCAGCTGTGTAAGGCAGG - Intronic
1171148711 20:22808328-22808350 TAGAAGCATCAGTTTGAGGCTGG + Intergenic
1171412301 20:24955757-24955779 AGGCTGCAGCAGTTTCAGGGGGG + Intronic
1173786486 20:45796946-45796968 AGGCACCAACAGTTAGAGGCGGG - Intronic
1173997053 20:47346439-47346461 GGGGAGCAGCAGGAGGAGGCTGG - Intronic
1174399389 20:50267767-50267789 AGGGAGCTGGAGTAGGAGGCGGG - Intergenic
1175401167 20:58700886-58700908 AGGGAGCACCAGGCTCAGGCAGG + Intronic
1175841724 20:62032257-62032279 AGGGAGCAGGAGTTCGGGGGTGG - Intronic
1175881514 20:62262139-62262161 TAGGAGCAGGAGTGTGAGGCCGG - Intronic
1175928913 20:62484458-62484480 TGGGGGCAGCAGCTTCAGGCCGG - Intergenic
1176049015 20:63106846-63106868 AGCGAGCTGCAGTGTGAGGATGG + Intergenic
1176056868 20:63153406-63153428 AGGGAGCTGGGGTTTGAGTCTGG - Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1177051278 21:16238170-16238192 TGGGACCAGAAGGTTGAGGCTGG - Intergenic
1180017658 21:45097793-45097815 AGGGAGCAGCGGTTTGTCTCTGG - Intronic
1180101459 21:45589638-45589660 AGGGTGCAGGAGGCTGAGGCAGG + Intergenic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180587291 22:16904165-16904187 AGGAAGCAGATGTGTGAGGCTGG - Intergenic
1180801321 22:18633446-18633468 AAGGACCAGCAGCTTGGGGCTGG + Intergenic
1180926744 22:19560228-19560250 AGGGGGCAGCAACTGGAGGCAGG + Intergenic
1181220400 22:21361815-21361837 AAGGACCAGCAGCTTGGGGCTGG - Intergenic
1181786327 22:25229876-25229898 AGGGAGGATTAGGTTGAGGCAGG + Intronic
1181818498 22:25457699-25457721 AGGGAGGATTAGGTTGAGGCAGG + Intergenic
1182447462 22:30397906-30397928 AGGGGGCAACAGTTTGAGGGCGG + Intronic
949705893 3:6816456-6816478 TGGGAGCATCAGCTTGGGGCTGG + Intronic
954112937 3:48445900-48445922 AAGGAGCAGCAATTTGAGGTGGG - Intergenic
954361959 3:50126788-50126810 TGGGAGCAGAAGACTGAGGCAGG + Intergenic
954771032 3:52969100-52969122 GGGGAGCAGCAGCTTGATGCAGG - Exonic
955125260 3:56104948-56104970 AGGGAGCTGCAGTTTTAAACAGG + Intronic
955990228 3:64619040-64619062 ATGGAGCACCAATTTGAGGGTGG - Intronic
957574088 3:81986631-81986653 AGGCTGCAGCAGCTTGTGGCTGG - Intergenic
958640153 3:96795072-96795094 AGTGAGCATCTGTTTGGGGCTGG + Intergenic
960161051 3:114350888-114350910 GTGGAGCAGCAGTTTGGGCCTGG - Exonic
961319107 3:126060782-126060804 ACGGAGCAGCAGGTGGAAGCCGG + Intronic
961441867 3:126958160-126958182 AGAGAGCAGCAGTTGGGGGTGGG - Intronic
961681102 3:128600745-128600767 AGGGGGCAGCAGGTAGAGGAGGG - Intergenic
962361132 3:134743637-134743659 AGGATGCAGCAGTTTGCAGCAGG + Intronic
962464914 3:135649188-135649210 AGGAAGCTGCAGTGTGAGGAAGG + Intergenic
965619988 3:170633697-170633719 AGAGAGCAGCAGGTTGAGGGTGG - Intronic
967812917 3:193775542-193775564 AGGGAGTGGCAGTTGGAGGATGG - Intergenic
967828629 3:193899172-193899194 AGGGAGCAGATGTATGAGGGTGG - Intergenic
968529559 4:1083789-1083811 GGGGAGCTGCAGGTTGTGGCTGG + Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
969705067 4:8787236-8787258 TGGGGGCAGCACTTTGGGGCTGG - Intergenic
970421175 4:15906730-15906752 TGGGAGCATCATTTTCAGGCTGG - Intergenic
971278665 4:25222626-25222648 AGAGATCAGGAGTTTGAGACTGG + Intronic
972313932 4:37907999-37908021 AGGTAGCAGAAGTGTTAGGCTGG + Intronic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
975747003 4:77484646-77484668 AGGAAGGAGCAGTTGCAGGCAGG + Intergenic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
976178125 4:82374322-82374344 CGGGAGCAGCAGCGTTAGGCCGG + Intronic
979472539 4:121117655-121117677 AAGGAGCAGAAGGCTGAGGCAGG - Intergenic
981748294 4:148071317-148071339 AAGGAGCTTGAGTTTGAGGCTGG + Intronic
983993568 4:174152967-174152989 AGGAAGCAGCAATTGGAGCCTGG + Intergenic
987960870 5:24806526-24806548 AGGGAGCAGCCCTTTGAAGAAGG - Intergenic
988824650 5:34923371-34923393 AGGGAGCAGAAGCTTGAACCCGG - Intronic
989736617 5:44715361-44715383 AGAGAGGAGCACTTTGAGGGAGG - Intergenic
990953273 5:61319615-61319637 AGGGAGTAGCAGTTGGAAGGAGG - Intergenic
992027428 5:72684444-72684466 AGGAAGCAGAAATGTGAGGCAGG + Intergenic
992900729 5:81292450-81292472 AGAGAGGAGCAGTTAGGGGCTGG - Intergenic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
995991211 5:118241865-118241887 AGGGAGCAGGGGTGTGTGGCAGG - Intergenic
997361410 5:133297636-133297658 AGGGAGCAGGAGGCTGTGGCTGG - Intronic
997444124 5:133928902-133928924 AGGGAGCAGCTGGCTGAGGGAGG - Intergenic
997641173 5:135449787-135449809 AGGGAGCTGCAGCTGGAGGTGGG + Exonic
997816893 5:137027970-137027992 AGGGCACAGCAGTTTGGGGGTGG - Intronic
999603149 5:153289165-153289187 AGAGGTCAGGAGTTTGAGGCCGG + Intergenic
1000038463 5:157466945-157466967 AAGGAGCAGCCCTTAGAGGCCGG + Intronic
1001260051 5:170220640-170220662 AGGAAGAAGCACTTTGAAGCAGG + Intergenic
1001595637 5:172896998-172897020 AGGCAGCAGCAGATGGAGACTGG - Exonic
1001977810 5:176014542-176014564 ACTGAGCAGCTGTTTGAGTCAGG - Intronic
1002104578 5:176873829-176873851 AGGGAGCAGACGCTTGTGGCAGG - Intronic
1002239609 5:177829220-177829242 ACTGAGCAGCTGTTTGAGTCAGG + Intergenic
1002617445 5:180464485-180464507 AGAGCCCAGCAGTCTGAGGCCGG - Intergenic
1003191814 6:3881112-3881134 AGGGAGCAGCAGGTTGCCCCAGG - Intergenic
1005952475 6:30642078-30642100 AGGGAGCAGAGGTTTGGGGTTGG + Intronic
1005988602 6:30889803-30889825 GGGGAGGAGCAGGTTTAGGCTGG - Intronic
1006154707 6:32007906-32007928 AGGGGGCTGGAGTTAGAGGCTGG - Intergenic
1006161019 6:32040641-32040663 AGGGGGCTGGAGTTAGAGGCTGG - Intronic
1006364488 6:33607397-33607419 AGGCAGCTGCAGTTGGAGGCTGG + Intergenic
1006446700 6:34083823-34083845 AGGGAGCGGGGGTTTGAGGTGGG - Intronic
1007243966 6:40446830-40446852 AGGGAGCCCCAGTCTGAGGGGGG - Intronic
1007723760 6:43901643-43901665 AGGGAGCCCCAGTCTGAGGGAGG + Intergenic
1007750103 6:44066323-44066345 AGGGACCCCCAGTCTGAGGCGGG - Intergenic
1007750183 6:44066628-44066650 AGGGAGCCCCAGTCTGAGGGGGG - Intergenic
1007750195 6:44066666-44066688 AGGGAGCCCCAGTCTGAGGGGGG - Intergenic
1007750225 6:44066781-44066803 AGGGAGCCCCAGTCTGAGGCGGG - Intergenic
1007880647 6:45162307-45162329 TGAGGGCAGGAGTTTGAGGCAGG + Intronic
1010720651 6:79279739-79279761 CAGGAGCTGCAGGTTGAGGCCGG + Intergenic
1010854313 6:80818662-80818684 AGGTAGAAGAAGGTTGAGGCTGG + Intergenic
1010922454 6:81700541-81700563 AGAGAACAGCAGTTGGTGGCAGG - Intronic
1011551493 6:88534851-88534873 AGTGCGCAGCTGGTTGAGGCTGG + Intergenic
1012045678 6:94269985-94270007 AGGGAGCAGCTGTTTAGTGCTGG + Intergenic
1013049091 6:106514215-106514237 AGGGAGCAGAAGTGTGAGAAGGG - Intronic
1013749305 6:113384108-113384130 AGAGCCCAGGAGTTTGAGGCTGG - Intergenic
1014206991 6:118666684-118666706 AGGGAGCTGGATCTTGAGGCTGG - Intronic
1014432748 6:121389584-121389606 TGGGAGCTGCAGTTTGTGGGAGG - Intergenic
1018537419 6:164836258-164836280 GGGGAGCACCAGTCTGAGGTTGG - Intergenic
1019704293 7:2490140-2490162 TGGGAGCAGCAGTTGGAGCGGGG - Intergenic
1019922918 7:4174276-4174298 AGGGAGCTGGAGTATGAAGCCGG + Exonic
1020126247 7:5533957-5533979 AGGGAGGGGCAGTGTGAGGCAGG - Intronic
1021558787 7:21947761-21947783 AGGGAGCACAAATTTGAAGCAGG + Intergenic
1022426293 7:30271920-30271942 TGAGACCAGCAGTTTGAGACTGG + Intergenic
1022480544 7:30740593-30740615 AGGAAGCAGCAGGCGGAGGCTGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1024318833 7:48045467-48045489 AGAGAGCAGCGGTCAGAGGCTGG - Intronic
1026828331 7:73597186-73597208 TGTGAGCAGCTGTGTGAGGCAGG + Exonic
1027501521 7:78957847-78957869 AGGGAGCAGCAGCATCAGGCTGG - Intronic
1029152595 7:98491539-98491561 AGGCTGCAGCAGCTTGAGGCGGG + Intergenic
1030079883 7:105768119-105768141 AGGGAACATCAGTTGGTGGCAGG - Intronic
1030114982 7:106056056-106056078 AGGAAGAAGCAACTTGAGGCCGG + Intergenic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1032905489 7:136359769-136359791 AGGGAGCAGGTGGTTGGGGCAGG + Intergenic
1032995603 7:137442744-137442766 AGGGAGAAGGAGTTTTAGGCTGG - Intronic
1033741226 7:144277208-144277230 CTGGAGCAGCAGTTTGAGGCGGG + Intergenic
1033752677 7:144372406-144372428 CTGGAGCAGCAGTTTGAGGCGGG - Exonic
1034224383 7:149471507-149471529 AGGGAGGAGCAGGTTTGGGCAGG - Intergenic
1035430329 7:158815342-158815364 TAGGAGCAGTAGTTTGAGGCTGG - Intronic
1037230630 8:16653649-16653671 TGAGACCAGCAGTTTGAGACTGG + Intergenic
1037589126 8:20298564-20298586 AGGAAGCAACAGTGTGAGGCTGG + Intronic
1037905336 8:22713025-22713047 AGGGAGCAGAACTTTGGGGAGGG + Intergenic
1037997459 8:23363699-23363721 AGAGAGCAGCTCTTTGGGGCAGG - Intronic
1039794037 8:40897195-40897217 AGGAGGCAGAAGTTTGAGGAAGG + Intronic
1040800266 8:51331873-51331895 AGGGACCATCAGTTGGGGGCCGG - Intronic
1041143319 8:54845195-54845217 GGGGAGGAGCACTTTGGGGCTGG + Intergenic
1043536342 8:81209142-81209164 AGTGACCAACAGTTTGAGGCTGG - Intergenic
1045059093 8:98396678-98396700 AGGGAGTGGGAGTTTGAGTCTGG - Intergenic
1046020720 8:108661564-108661586 ATGGAGCAGCAGCTTGAACCAGG + Intronic
1046097623 8:109579534-109579556 AGGCAGCAGGAGGCTGAGGCAGG - Intronic
1046869826 8:119193488-119193510 AGGGAGAAGCATTTTGAAGCAGG + Intronic
1047192987 8:122695467-122695489 AGGGAGCAGGAGGATGAGGGGGG + Intergenic
1047360719 8:124166445-124166467 AGGTAGCAGCAGGGTGGGGCTGG - Intergenic
1047680267 8:127247571-127247593 AGGGAGAAGCATCTGGAGGCTGG + Intergenic
1048174895 8:132142786-132142808 AGGTAGCAGCAGCTTCTGGCAGG - Intronic
1053016562 9:34665475-34665497 AGGGAGCCGCTTTTAGAGGCGGG - Intronic
1053696213 9:40641770-40641792 AGGAAGCAGATGTGTGAGGCTGG - Intergenic
1054307460 9:63440989-63441011 AGGAAGCAGATGTGTGAGGCTGG - Intergenic
1054439820 9:65250473-65250495 AGGAAGCAGATGTGTGAGGCTGG - Intergenic
1054490587 9:65771466-65771488 AGGAAGCAGATGTGTGAGGCTGG + Intergenic
1055021505 9:71675319-71675341 AGGAAGCAGAACCTTGAGGCAGG - Intergenic
1057695010 9:97316974-97316996 AGAGAGGAGCAGTGGGAGGCTGG - Intronic
1058636577 9:107044041-107044063 CGGGAGCAGCAGATGGAGCCGGG + Intergenic
1058720970 9:107763404-107763426 TGGGAGCAGGAGTTGGAGGGAGG - Intergenic
1059154799 9:111980169-111980191 ATGGAGCAGTAGTACGAGGCTGG - Intergenic
1059406383 9:114100202-114100224 ATGGAGAGGTAGTTTGAGGCTGG + Intergenic
1060218543 9:121752608-121752630 AGGAAGCAGGAGTCTCAGGCAGG - Intronic
1060222493 9:121772102-121772124 AGGGAGCGGCAGCAGGAGGCTGG + Intronic
1060283148 9:122227314-122227336 CGTGAGCAGCAGTTCGTGGCCGG + Intronic
1060286242 9:122255518-122255540 AAGGATCATCAGTTTGTGGCAGG - Intronic
1060400291 9:123344609-123344631 AGGGAGCAGCATCTTGCGGGCGG + Intergenic
1060735869 9:126066299-126066321 AGGCAGCAGCATGTGGAGGCTGG - Intergenic
1061489333 9:130936552-130936574 AGGGAGCAGCAGAGGAAGGCGGG + Intronic
1061596801 9:131635742-131635764 AGGGGGCAGCAGGTTGGGGGTGG + Intronic
1061700429 9:132411052-132411074 AGGGAGCTGCGGTTTCGGGCTGG + Intronic
1061763718 9:132868505-132868527 AGGGAGAAGGAGTGGGAGGCTGG - Intronic
1062511710 9:136909887-136909909 AGGGATCAGGAGTGTGAGGGTGG - Intronic
1202778662 9_KI270717v1_random:15431-15453 AGGAAGCAGATGTGTGAGGCTGG - Intergenic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203585737 Un_KI270747v1:1840-1862 AGGAAGCAGATGTGTGAGGCTGG - Intergenic
1188320577 X:28732009-28732031 AAGGAGCTGGAGTCTGAGGCAGG + Intronic
1188454590 X:30348674-30348696 GGAGACCAGTAGTTTGAGGCTGG + Intergenic
1188673835 X:32913982-32914004 AGGGAGCACAAGTGGGAGGCAGG - Intronic
1189241397 X:39527322-39527344 AGAGAGAAGCAGTTGGAGACTGG - Intergenic
1190335879 X:49261390-49261412 GGGGAGGAGGAGGTTGAGGCTGG + Intronic
1196856512 X:119990305-119990327 TGGAAGCAGAAGTTTGGGGCTGG - Intergenic
1197472194 X:126877643-126877665 AGGTAGGAGCAGTGTTAGGCAGG + Intergenic
1197872225 X:131071241-131071263 AGGGAGCAGCAGTTTGAGGCTGG - Intronic
1198591605 X:138189254-138189276 AGGATGCAGAAGTTTGAGGTTGG + Intergenic
1201286022 Y:12379414-12379436 AGGGAGCAGGAGTCTCAAGCAGG + Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic