ID: 1197873076

View in Genome Browser
Species Human (GRCh38)
Location X:131078475-131078497
Sequence CATGGTATACTGAAGGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197873076 Original CRISPR CATGGTATACTGAAGGGGTA AGG Intronic
910895923 1:92069289-92069311 CATGGTGACATGAAGGGGTAGGG - Intergenic
912225544 1:107729547-107729569 CATGGTGCACTGAAGGGGCATGG + Intronic
915572594 1:156752476-156752498 CACAGTTTACTGAAGGGGTTGGG - Intronic
916856663 1:168757102-168757124 CATGGGGTAATGAAAGGGTAAGG + Intergenic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
919852995 1:201686284-201686306 GATGGAATACTGAGGGGGCAGGG - Intronic
921142974 1:212323431-212323453 CATTATATACTTAATGGGTAGGG + Intronic
921252050 1:213307427-213307449 CATGTGAAACTGAAGGCGTAAGG + Intergenic
923585679 1:235268001-235268023 CATGGATTTGTGAAGGGGTAAGG + Intronic
1066585062 10:36923934-36923956 CATGGTACACTTAAAGGGAAGGG + Intergenic
1068660847 10:59621990-59622012 CATGCAATACTGCAGGGGAAAGG - Intergenic
1071052478 10:81468122-81468144 CATAGTATACTGCAGTGCTACGG - Intergenic
1072874952 10:99162733-99162755 CTTGGTAAACTGAAGGGGCAGGG - Intronic
1073613661 10:104970547-104970569 CATGGCACTATGAAGGGGTAGGG - Intronic
1077284344 11:1759151-1759173 CATGGTAGATTGTAGGGGGATGG - Intronic
1079303613 11:19302553-19302575 CATGGTTTACTGAATGATTAAGG - Intergenic
1079862196 11:25687143-25687165 AGTGGAATACTGATGGGGTAGGG + Intergenic
1081134708 11:39425814-39425836 CATGCTATAGTGAAGTGGTAAGG - Intergenic
1083777050 11:64899204-64899226 CATAGAATAGAGAAGGGGTAGGG - Intronic
1083815766 11:65131588-65131610 GATGGCATACTGAAGGGAGAGGG + Exonic
1083843911 11:65320128-65320150 CATGGGATCCTGAGGGGGTGGGG - Intronic
1085903131 11:80726222-80726244 CATGGTACACTTAAAGGGAAGGG - Intergenic
1089317091 11:117599568-117599590 CATGGTATAGAGAGGGGCTACGG - Intronic
1092619986 12:10253572-10253594 CATGGTCTACTCAAGGGGATAGG - Intergenic
1096340250 12:50791997-50792019 CATGCTATTCTGAAGAGATATGG - Intronic
1097410145 12:59242333-59242355 AATGGAATACTGAAGGACTATGG - Intergenic
1106699571 13:32214697-32214719 GATGGGTTACTGAAAGGGTAAGG - Intronic
1111633882 13:90878550-90878572 TATGGTATATTGAAAGGGTTTGG + Intergenic
1112359711 13:98706434-98706456 CACGGAATACTGAAGTGATATGG + Intronic
1112833489 13:103483044-103483066 CATGGTATACTGGATGGGAAAGG - Intergenic
1114127413 14:19745422-19745444 CATAGTATACCAAAGGTGTATGG - Intronic
1116093078 14:40333589-40333611 CAAGGTATGATGAAGGGGCATGG - Intergenic
1116157096 14:41219256-41219278 TATGGTATAAGGAAGGGGTCTGG - Intergenic
1118927160 14:70202507-70202529 CATGGTATGATGCAGGGGTCTGG + Intergenic
1121808805 14:96859406-96859428 TCTGTTATACTGAAGGGATATGG + Intronic
1122404722 14:101493197-101493219 CATGGGGTCCTGGAGGGGTAGGG - Intergenic
1125376744 15:39038266-39038288 CATGGCATACTGAATGAGCAGGG - Intergenic
1128675723 15:69607154-69607176 CATGGCATCCTGAAGATGTAAGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1136315383 16:29451883-29451905 TATGGCATACTGAAGAGGTGGGG - Intronic
1136429960 16:30191225-30191247 TATGGCATACTGAAGAGGTGGGG - Intergenic
1140516008 16:75542394-75542416 CATGGGATGCTGGAGGGGTGGGG + Intronic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1145828769 17:27898042-27898064 CCGGGTATACTGCAGTGGTAAGG + Intergenic
1150911388 17:69390986-69391008 CATGGTACAAAGCAGGGGTAGGG + Intergenic
1153483371 18:5570387-5570409 CAAGTTATACTGAAGAGGAAAGG + Intronic
1158940557 18:62403166-62403188 CAGCCTCTACTGAAGGGGTACGG - Intergenic
1159651176 18:70981173-70981195 CAAGGTAGTCTGAAGGGATAGGG + Intergenic
1160010974 18:75106964-75106986 CCTGGTATAATGAATGGGTGGGG - Intergenic
1160249963 18:77193962-77193984 CAAGGCCTACTGAAGGGGTTGGG - Intergenic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
926261470 2:11267669-11267691 TAGGATATACTCAAGGGGTATGG - Intronic
926261874 2:11271668-11271690 TAGGATATACTCAAGGGGTATGG + Intronic
931727456 2:65125144-65125166 CATGATATACTTAAGGGGATGGG + Intronic
932499155 2:72166768-72166790 CAGCCTATACTGAAGGGGCAGGG - Intergenic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
942869714 2:180720355-180720377 CAACGTAAACTGAAGGTGTAAGG - Intergenic
1169547419 20:6664604-6664626 CAACCCATACTGAAGGGGTAGGG + Intergenic
1171139643 20:22729713-22729735 GAGGGTTTAATGAAGGGGTATGG + Intergenic
1177758727 21:25378427-25378449 TATGGTATAAGGAAGGGGTCTGG - Intergenic
1181913498 22:26259552-26259574 CATGGTAGAATAAAGGGGTCAGG + Intronic
1182515915 22:30859027-30859049 CATGGGGCCCTGAAGGGGTAGGG - Intronic
949550035 3:5104987-5105009 AATGGTATACCAAAGAGGTAGGG - Intergenic
953691112 3:45120454-45120476 CATTGTAAAATGAAGGGGTGGGG + Intronic
955258046 3:57354957-57354979 CAAGGGTTACGGAAGGGGTAAGG + Intronic
956626674 3:71273535-71273557 CAAGGAAGACTGAAGGGGGATGG - Intronic
958814966 3:98904444-98904466 CCTGCTATATTAAAGGGGTAGGG - Intergenic
962856110 3:139346319-139346341 TATGGTATACAGGAGAGGTACGG - Intronic
967039497 3:185677168-185677190 CATGGCATACTGAAGAGCAAAGG + Intronic
969606435 4:8204470-8204492 CATGGTGTTCTGGAGGGGCAGGG + Intronic
975247207 4:72133178-72133200 CATGGTATAAGGAAGGGGTGTGG + Intronic
976244091 4:82990150-82990172 CATGGCATTCTGAAGGAGGAAGG - Intronic
979032071 4:115662060-115662082 CATGGTATACTAGAGTGCTAAGG - Intergenic
994993662 5:107031392-107031414 CATGGAAGATTGAAGGGTTAAGG - Intergenic
998700226 5:144689896-144689918 AATGGGATATTGAAGGGCTATGG - Intergenic
1001250379 5:170142469-170142491 CATGGCCTACTGAAGGGGACAGG + Intergenic
1001300698 5:170531674-170531696 CATGCTGTACTGTAGGGGAAAGG - Intronic
1007990875 6:46254779-46254801 GATGTCATACTGAAGTGGTATGG + Intronic
1012814041 6:103999360-103999382 CATGGTGTAAGGAAGGGGTCCGG - Intergenic
1015034279 6:128634206-128634228 CACAGTATTTTGAAGGGGTATGG + Intergenic
1020671161 7:11114603-11114625 CATGCTATACTTCATGGGTATGG - Intronic
1022198547 7:28093952-28093974 TATGGAATACTGAAGAGGGAGGG - Intronic
1027773512 7:82435974-82435996 CATTGCATACTGAAGGGGCATGG - Intronic
1028413749 7:90558332-90558354 CATGGTGGAGTGATGGGGTAGGG + Intronic
1031482301 7:122293018-122293040 CCTGGTAAACTAAAGGAGTATGG - Intergenic
1032388215 7:131538935-131538957 CATGGTCTGCTGCAGGGGAAGGG - Intronic
1034477956 7:151298589-151298611 CATTCTAGACTGCAGGGGTAGGG - Intergenic
1044891013 8:96835602-96835624 TATGGTATAGTGAAGAGTTAGGG + Intronic
1046279519 8:112007331-112007353 TATGGTATAATGAAGGGGTCTGG + Intergenic
1046719357 8:117601576-117601598 GATGGTATACTGGAGGGATATGG - Intergenic
1046979696 8:120323594-120323616 TATGGTATAAGGAAGGGGTCCGG + Intronic
1048837755 8:138537452-138537474 CATGGTATACTCCATGGGAAGGG + Intergenic
1058678507 9:107421788-107421810 CATGGTATAGTGTGGGGGTGGGG - Intergenic
1186563026 X:10632910-10632932 AATGGTAGACTGAATGGGCATGG - Intronic
1188362386 X:29272083-29272105 CATGGTGTAAGGAAGGGGTCCGG + Intronic
1197873076 X:131078475-131078497 CATGGTATACTGAAGGGGTAAGG + Intronic
1200751140 Y:6945261-6945283 GATGGAATACGGAAGGGGAAAGG - Intronic
1201855149 Y:18533540-18533562 CATGGTATATTGAAAAGGGATGG + Intergenic
1201878172 Y:18786844-18786866 CATGGTATATTGAAAAGGGATGG - Intronic
1202172760 Y:22068116-22068138 CATGGTATATTGAAGAGGGATGG - Intergenic
1202218602 Y:22518255-22518277 CGTGGTATATTGAAGAGGGATGG + Intergenic
1202324584 Y:23677800-23677822 CATGGTATATTGAAGAGGGATGG - Intergenic
1202546187 Y:25992254-25992276 CATGGTATATTGAAGAGGGATGG + Intergenic