ID: 1197873664

View in Genome Browser
Species Human (GRCh38)
Location X:131083071-131083093
Sequence CCTGATCTGCAGCAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197873664 Original CRISPR CCTGATCTGCAGCAGGGGGA GGG (reversed) Intronic
900462336 1:2807681-2807703 GCTGTTCTGCAGGTGGGGGAGGG - Intergenic
900595865 1:3479892-3479914 CTGGTTCTGCAGCAGGAGGATGG + Exonic
902707685 1:18217015-18217037 CCAGACCCACAGCAGGGGGAGGG + Intronic
903693695 1:25192480-25192502 CCTGTTCTGGGGCAGTGGGAAGG - Intergenic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904535079 1:31194103-31194125 CCTGATCTCCCGCCAGGGGAAGG + Intronic
904921566 1:34012188-34012210 CCTGATCTGCTGGAGGAGCAAGG - Intronic
905365208 1:37447679-37447701 GCTGACCTCCAGCAGGGGCATGG - Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905619056 1:39425355-39425377 GTTCATCTGCAGCTGGGGGATGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905858636 1:41331305-41331327 CCTGAGCCGCAACAGGGGGAGGG + Intergenic
905947921 1:41919316-41919338 CCTGATCTGCAGCCAGAGGCTGG - Intronic
907496875 1:54851297-54851319 GCTGCTCTGCAGCAGGGGCTGGG - Exonic
907853440 1:58278707-58278729 CCTGATCAGCAGCAGGCGGGGGG + Intronic
911345011 1:96685951-96685973 TCTGATCTGATGCAGGGAGAAGG - Intergenic
912504860 1:110149679-110149701 CCTGAGCTGGAGCAGGGGTGGGG - Intergenic
913111849 1:115664166-115664188 CCTGAGCTCCAGCAGGACGATGG - Exonic
913213352 1:116599954-116599976 CCTGATCTCCAGCAGGTTGGAGG + Exonic
913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG + Intergenic
913502281 1:119482326-119482348 CCTGATTTGCAGCAGTGGTGGGG + Intergenic
913517582 1:119617585-119617607 CCTGATTTGCAGCAGTGGTGGGG + Intergenic
914690135 1:150018424-150018446 TGTGATCTGCAGCCCGGGGAAGG - Intergenic
915341154 1:155177463-155177485 CCTGGGCTGCAGGAGGGGGCAGG + Intronic
915484940 1:156213617-156213639 CCTGATCTGTAGCCGGGCGCGGG - Intronic
915907791 1:159891643-159891665 CCTGACCAGAGGCAGGGGGATGG + Intronic
916479203 1:165200234-165200256 CATGACCTGCATGAGGGGGAAGG - Intergenic
917516771 1:175714894-175714916 CCTGGTCAGCAGCAGGGGAGAGG + Intronic
918316280 1:183325130-183325152 CCTGATCTGCTGAAGTGGGAAGG + Intronic
920032291 1:203044699-203044721 TCTGCCCTGCAGCAGGGGGCAGG + Intronic
920298766 1:204975807-204975829 CCTAATCTTCAGCAGAGGGCAGG + Intronic
920336941 1:205251213-205251235 CCTGAGCTGCAGTAGGGAGTTGG + Intronic
920585010 1:207150338-207150360 CCTGTTAGGCGGCAGGGGGAGGG - Intergenic
921220811 1:212972464-212972486 CCTGCTCAGAGGCAGGGGGATGG + Intronic
923070547 1:230560601-230560623 CATGCTCTGCAGAAGGGGGTAGG - Intergenic
1062917963 10:1256364-1256386 CATGACCTGCAGCAGCGGGTGGG + Intronic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1064891010 10:20173511-20173533 CCTGATCAGCATCAGCAGGAGGG - Intronic
1065620344 10:27574710-27574732 CATGATCTCCAGCAGGAAGATGG - Intergenic
1066362973 10:34748762-34748784 CCTGCACTGCAGCAGGGAGCGGG - Intronic
1066416483 10:35226384-35226406 GCTGCCTTGCAGCAGGGGGAAGG + Intergenic
1067036918 10:42927669-42927691 CCAGATCAGCAGCATGGGGGAGG - Intergenic
1068015202 10:51507144-51507166 CCTGTTGTGGAGTAGGGGGAGGG + Intronic
1069572733 10:69504170-69504192 CCTGATCTGCTGCTAGTGGAGGG + Intronic
1069786484 10:70991334-70991356 TCTGATCTCCAGGAGGCGGAGGG + Intergenic
1069892016 10:71657867-71657889 CTTTATCTGCAGCCTGGGGAGGG + Intronic
1070058015 10:72953953-72953975 TGTGAACTGCAGCAGGGGGAAGG + Intronic
1070192078 10:74120521-74120543 TCTGTCTTGCAGCAGGGGGAAGG - Intergenic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070685399 10:78476808-78476830 CTTGATCTGGGGCAGGGGCAGGG - Intergenic
1070848348 10:79542108-79542130 TCTGATCTCCAGCCTGGGGAGGG + Intergenic
1070925437 10:80218061-80218083 TCTGATCTCCAGCCTGGGGAGGG - Intergenic
1071207811 10:83302235-83302257 CCTGCTCTGCATCTGTGGGAGGG + Intergenic
1071256588 10:83877261-83877283 CCTCATCTGCAGTGGAGGGATGG - Intergenic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1073136601 10:101223858-101223880 CCAGAGCTGCGGCGGGGGGAAGG - Intergenic
1074601366 10:114917164-114917186 CCTCATTTCCAGCAGGAGGAAGG + Intergenic
1075178311 10:120186146-120186168 CCTATTCTGCTGAAGGGGGATGG + Intergenic
1076404090 10:130201018-130201040 CCTGTTCTGCAGGAGGGGAGAGG + Intergenic
1076518152 10:131061718-131061740 CCAGCTCTGCAGGAGGAGGATGG - Intergenic
1076610511 10:131723165-131723187 CCTGCTCCGCACCAGGGAGAGGG - Intergenic
1076872647 10:133201299-133201321 CCTGAACTGCCGCACGGGGCCGG - Intronic
1076888767 10:133274158-133274180 CCTGTTCTTCCGCAGGTGGAGGG + Exonic
1077269006 11:1666333-1666355 CCCGATCTGCAGCCGGGGTCTGG + Intergenic
1077271543 11:1684382-1684404 CCCGATCTGCAGCCGGGGTCTGG - Intergenic
1079029897 11:16978906-16978928 CCTGAACTGCAGCAGGGTGTGGG - Intronic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1083658409 11:64241274-64241296 CCGGAGATGCCGCAGGGGGAGGG + Intronic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1083684849 11:64369947-64369969 CCTGATGTGCAGCAGCACGAGGG + Intronic
1083827508 11:65211793-65211815 CCTGGTCGGCAGCAGGGCCAGGG - Exonic
1084980367 11:72825613-72825635 CCAGATTTGCAGGATGGGGAGGG + Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085457268 11:76672121-76672143 CCTGAGCTGCAGTGAGGGGATGG + Intergenic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1086812463 11:91327810-91327832 TCTGATGAGCAGCAGTGGGAGGG + Intergenic
1087622222 11:100555197-100555219 TATGATCTGCTTCAGGGGGAAGG - Intergenic
1088850313 11:113698684-113698706 CCTGATCTCTAGCTGGGGCAAGG - Intronic
1089086085 11:115818022-115818044 CCTCCTCTGGAGCAGGGGAAGGG + Intergenic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091450661 12:570335-570357 CCTGCTCTGCGGCAGAGGGATGG + Intronic
1091781514 12:3216978-3217000 CCTGAACTGCAGTTGGAGGAAGG + Intronic
1091930644 12:4392638-4392660 CCTGACCTCCAGCAGGCTGAGGG - Intergenic
1092880131 12:12881782-12881804 CCTGGCCTGCGGCAGGGGGGCGG - Intergenic
1093872973 12:24314358-24314380 CCTGTTGTGGAGTAGGGGGAGGG + Intergenic
1094842947 12:34349569-34349591 GCGCATGTGCAGCAGGGGGAGGG + Intergenic
1096173863 12:49498085-49498107 GCTGATCTGCAACAGGCTGAGGG - Intronic
1096191214 12:49621446-49621468 CCAGATGTGCAGCAAGGTGAGGG + Intronic
1096256114 12:50063333-50063355 GCTGAGCAGCAGCAAGGGGAGGG + Intronic
1096560748 12:52434170-52434192 CCCGCTCTGCAGCAGGGAGTGGG - Exonic
1097797674 12:63880973-63880995 CCGGATCAGGAGTAGGGGGAGGG + Intronic
1098371699 12:69767408-69767430 CCTGCTCAGCTCCAGGGGGATGG + Intronic
1101405537 12:104425545-104425567 CCAGATCTTCAGCAGGGAGCTGG + Intergenic
1101434729 12:104654882-104654904 CCTGTTCTGGAGATGGGGGAGGG - Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102131738 12:110536293-110536315 CCTGATCTCCAGGAGGGGTAGGG - Exonic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102571917 12:113831901-113831923 CCTGCACTGCTGCAGGGAGAAGG + Intronic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103526951 12:121575457-121575479 CCTGATCTGGAGCAAGGGGAAGG + Intronic
1104015622 12:124959931-124959953 CCTGCCCTGGAGCAGGGGGAGGG + Intronic
1104884677 12:132099881-132099903 ACAGAGCTGCAGCAGGGAGAAGG - Intronic
1105706573 13:22971148-22971170 CCTGATCTCCAGGACTGGGATGG - Intergenic
1106407178 13:29484299-29484321 CCTGCTCTGCAGGAGGGCTAAGG - Intronic
1106451817 13:29889013-29889035 CCTGAGCTGCTCCACGGGGATGG - Intergenic
1107056480 13:36110020-36110042 TCTGAAGTGCAGCAGGGAGAGGG + Intronic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1113292913 13:108925725-108925747 CCTGTACTGCAGCAGAGAGATGG - Intronic
1113842382 13:113367456-113367478 CCTGATTTTCAGCAGAGGGCTGG + Intergenic
1114835316 14:26196985-26197007 CCTGATCTGCAGGCCAGGGATGG - Intergenic
1115641642 14:35339082-35339104 CCTGAACTGCAGCCCGGGGATGG - Intergenic
1115941626 14:38617190-38617212 CTTGCTCTGCAGCAGGTGAAGGG + Intergenic
1116078526 14:40143830-40143852 CCTGTTGTGGGGCAGGGGGAAGG + Intergenic
1116490246 14:45496388-45496410 CCTGATGTGCAGGAAAGGGAGGG + Intergenic
1119566895 14:75636472-75636494 CTTGCTCTGCGGCAGGAGGAGGG + Intronic
1119643898 14:76334879-76334901 GCTGGTCTGCAGCAGGGACAGGG + Intronic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1121126823 14:91413329-91413351 CCTGATCTGTAATAAGGGGATGG - Intronic
1121277210 14:92676585-92676607 CCCGCCCTGCAGCTGGGGGAGGG + Exonic
1122313134 14:100809943-100809965 CCTGATCTGCAGCTGGGGCTTGG + Intergenic
1122409084 14:101516989-101517011 CCAGAGCCGCAGCAGGGGCAGGG - Intergenic
1122664468 14:103319095-103319117 CCTGTTTTTCAGCAGTGGGATGG - Intergenic
1202852581 14_GL000225v1_random:30708-30730 GCTGGGCTGGAGCAGGGGGACGG - Intergenic
1124259410 15:28175317-28175339 CCTGCTTTGCAGCAGGGGTTGGG - Intronic
1124317190 15:28680627-28680649 CCTGCTCAGCAGCAGGGGTTGGG - Intergenic
1124439281 15:29675039-29675061 CCAGAGCTGCAGCAGGAGGTCGG - Intergenic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129359208 15:75013925-75013947 GGTGATCTGTAGCAGGGGGTGGG + Intronic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1133736351 16:8618988-8619010 CCATGTCTGCAGCAGAGGGAAGG - Intergenic
1133932298 16:10242374-10242396 CATGACCTGCAGCAGGCGGCTGG + Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1135185239 16:20309987-20310009 CCTTATCTGTAGCTGTGGGAAGG + Intronic
1135804401 16:25529030-25529052 CCTCATATGGTGCAGGGGGAAGG + Intergenic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1137960819 16:52880242-52880264 CCCGTTCTGCATCTGGGGGAGGG + Intergenic
1138547354 16:57727758-57727780 CCTGCTCTCCAGCACAGGGAGGG + Intronic
1139188676 16:64836723-64836745 CCTGATCAGCAGGAGGAGGCGGG - Intergenic
1139582189 16:67880292-67880314 CAGGATCAGCAGCAGGGGGCTGG - Intronic
1139917595 16:70438232-70438254 CCAGAGCTGTAGCAGGGGGTGGG + Intronic
1140132848 16:72179176-72179198 CCTGCTCTCCAGCAGGAGAAGGG + Intergenic
1140442718 16:74999598-74999620 ACTTCTCAGCAGCAGGGGGAGGG - Exonic
1141200178 16:81891678-81891700 CCTGTTGTGAAGCAGGTGGAGGG + Intronic
1141793908 16:86256590-86256612 CCTCATTGTCAGCAGGGGGAGGG + Intergenic
1141996453 16:87639208-87639230 CCTCATCTGCAACGAGGGGAGGG - Intronic
1142147294 16:88497926-88497948 CCTGATGGACAGCAGGGAGATGG + Intronic
1142933416 17:3307839-3307861 CCTGGCCTGCAGCATGGGGCTGG - Intergenic
1143082781 17:4394044-4394066 GCAGATTTGCAGCAGGGGAATGG + Intergenic
1143682551 17:8488124-8488146 CCTGCTCTGGAGCAGGCAGATGG + Intronic
1143717566 17:8785913-8785935 CCTGAGCTGCAGCTTTGGGAAGG + Intergenic
1143906057 17:10210111-10210133 CCTCATCTGCAGGACAGGGATGG + Intergenic
1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG + Intronic
1144215056 17:13048097-13048119 CCTGACCTCCAGCAGGCTGATGG - Intergenic
1144669065 17:17121596-17121618 CCCCATCGGCAGCAGGGGAAGGG + Intronic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145825006 17:27870285-27870307 ACTGATCTGCTGCAGACGGATGG - Intronic
1145907844 17:28526025-28526047 CCTCATCTGCAACACGGGTATGG - Intronic
1146277304 17:31523876-31523898 GCTTACCTGCAGCAGGGGGCCGG - Exonic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1152023450 17:77793953-77793975 CCAGCTCTGCAGCCGGGAGAGGG - Intergenic
1152209695 17:78996504-78996526 CCTGAACCCCAGCAGGGGGAGGG - Intronic
1152353661 17:79796847-79796869 GCTGGGCTGCAGCAGGGGGAGGG + Intronic
1152357360 17:79813592-79813614 CCTGCAATGCAGCAGGGGGAGGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153815617 18:8787476-8787498 CCTGATCTGCAGTAGTGGGACGG + Intronic
1154173180 18:12065605-12065627 CCAGATGTGCAGCAGGGGATGGG - Intergenic
1155347294 18:24870751-24870773 CGTGATCTGCACCAGGGCAATGG + Intergenic
1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG + Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157424313 18:47571835-47571857 TAGGATCTGGAGCAGGGGGAAGG + Intergenic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157569225 18:48701253-48701275 CCTGGTCTGCAGCAGCTTGAAGG + Intronic
1157724620 18:49954488-49954510 CCTGGGTTGCAGCAGAGGGATGG + Intronic
1160495044 18:79368359-79368381 CCTGATCTGTTGCCGAGGGATGG - Intronic
1160667066 19:335879-335901 CCTGTTCTTTAGCAGGGGCAGGG - Intronic
1160879705 19:1313752-1313774 CCTTGTCTGGAACAGGGGGAGGG + Intergenic
1160975844 19:1792019-1792041 CCGGTTCTGCAGCAGGAGGCTGG + Exonic
1161072548 19:2269997-2270019 CCTGATTTGCGGGAGGGGCATGG + Intronic
1161338204 19:3725992-3726014 CCTGATCTCCAGGAGTGGGAAGG - Intronic
1161527243 19:4764022-4764044 CCTGACCTGCAGCCTGGGCAAGG - Intergenic
1161651672 19:5489613-5489635 CCTGATTTGGAACTGGGGGATGG - Intergenic
1161980614 19:7628357-7628379 CCTGAGCCCCAGCAGTGGGATGG - Intronic
1162009315 19:7802222-7802244 CCTGACCTCCAGGAAGGGGAAGG - Intergenic
1163701961 19:18790608-18790630 CCTGACCTGCAGGGGTGGGATGG + Exonic
1164649384 19:29881016-29881038 TCTGAGCTGCAGCTGGGAGAGGG + Intergenic
1165094783 19:33404154-33404176 CCAGAGCTACAGCAGTGGGAGGG - Intronic
1165905561 19:39192527-39192549 CCCTCTCTCCAGCAGGGGGATGG - Intergenic
1166067409 19:40367897-40367919 CCTGGCCGGCAGCAGGGGCAGGG + Intronic
1166427468 19:42692241-42692263 ACTGTCCTGCAGCAGGGGCAGGG + Intronic
1166509250 19:43393314-43393336 CCTGAGCTGCTCCACGGGGAGGG + Intergenic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
1167493036 19:49802694-49802716 CCTGATGAGCAGCAGAGGCAGGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168720031 19:58549771-58549793 CCTGACCTGAAGGAGGAGGATGG + Exonic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925325589 2:3019451-3019473 CCTGATGGGCCGCAGTGGGAAGG + Intergenic
925347352 2:3180205-3180227 CCTGATCTGGAGGAGTGTGAAGG + Intergenic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
926442016 2:12899499-12899521 CCCTATCTGAAGCAGGAGGATGG - Intergenic
926446466 2:12948511-12948533 TGTGATCTGGAGCAGGAGGAGGG + Intergenic
934939881 2:98493027-98493049 CCTGATGGGCAGCTGGTGGAGGG - Intronic
935507579 2:103925353-103925375 CCTGGCCTGCAGCATGGGGCTGG + Intergenic
935650622 2:105378889-105378911 CCTGTACTGCAGCAGGGAGGTGG - Intronic
937365424 2:121257505-121257527 CCTGAAGAGCAGCAGGGGGCAGG + Intronic
938377947 2:130820724-130820746 CCTCCTCTGCGGCACGGGGAAGG + Intergenic
940435293 2:153646610-153646632 CCTGTTGTGGAGTAGGGGGAGGG - Intergenic
941346661 2:164377481-164377503 CCTGCCCAGAAGCAGGGGGATGG + Intergenic
942242189 2:173972814-173972836 CTTGAACTGAAGCATGGGGAGGG - Intergenic
942838416 2:180329416-180329438 CCTGTTCTCCAGCAGAGGAAAGG - Intergenic
944206672 2:197164469-197164491 GCTGCTCTTCAGCTGGGGGAAGG - Intronic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
945273193 2:207962202-207962224 CCTGACCTCCAGGAAGGGGAAGG + Intronic
945339800 2:208639505-208639527 CCTGATATGGACCAGGAGGAAGG + Intronic
946941989 2:224779049-224779071 TCTGGTTTGAAGCAGGGGGAAGG + Intronic
948084163 2:235232533-235232555 CCTGATCTGGAGCAGGAGAGCGG + Intergenic
1171493349 20:25537696-25537718 CCTGGGCTGCTGCAGGTGGAGGG + Intronic
1171780237 20:29410938-29410960 GCTGGGCTGGAGCAGGGGGACGG + Intergenic
1171824201 20:29879202-29879224 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174535637 20:51249155-51249177 CCGGTCCTGCAGCAGTGGGAAGG - Intergenic
1174581749 20:51577076-51577098 CCTCATCAGCATCAGGGTGATGG + Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175723962 20:61304120-61304142 CCTGATCTGCAGCTGAGGAAAGG - Intronic
1177856243 21:26403800-26403822 CCTGATCAGCAACACTGGGAAGG + Intergenic
1179728543 21:43354332-43354354 CCAGCTCTGCCGCAGGAGGAGGG + Intergenic
1180006945 21:45027229-45027251 TCTGTCCTGCAGCTGGGGGAGGG + Intergenic
1180059431 21:45376919-45376941 CATGTTCTGCAGCAGAGGGAGGG + Intergenic
1181284011 22:21739282-21739304 CCGGAGGTGCAGCAGGCGGAGGG - Intergenic
1181669435 22:24419284-24419306 CCTGCTGTGAGGCAGGGGGAGGG + Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182891285 22:33820820-33820842 CCTGAGCAGCAGCAGGGACAAGG - Intronic
1183346969 22:37313312-37313334 CCTGCTCTGCCGCGGGGGAAAGG - Intronic
1183583091 22:38737284-38737306 GCTGATGTGGAGCAGGGGGCAGG - Intronic
1184115107 22:42417667-42417689 CCTGCCCTGCTGCAGGGGCAGGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
949869102 3:8571646-8571668 CCTGGTCTGCAGCTGGAGAAAGG + Intergenic
950020205 3:9781757-9781779 GCTGCTCTGCAGCAGGGTAAGGG + Intronic
952282722 3:31938996-31939018 GTTGATCTGAAGCAGGAGGAAGG - Intronic
952625703 3:35400296-35400318 CCTGATTTGCAGCATATGGAAGG + Intergenic
955573919 3:60338079-60338101 CCTGAGATGCAGCAGGGGACAGG + Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
957265951 3:77966105-77966127 CCTGTCCTGGAGTAGGGGGAAGG + Intergenic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
959553181 3:107687472-107687494 CCTTATCTCCAGCAGGGGCCAGG - Intronic
959820180 3:110724788-110724810 CCTGATCTGCAGTATGTGGCAGG + Intergenic
959865619 3:111266718-111266740 CCTGATTTGCAGCAGTGCCAAGG - Intronic
961483256 3:127197280-127197302 TCTGAACTGCAGCAGGGCAAAGG - Exonic
962751184 3:138435587-138435609 CCTGGACTGCGGTAGGGGGAGGG + Intronic
963003522 3:140705200-140705222 TGAGATTTGCAGCAGGGGGAGGG - Intergenic
964719694 3:159758872-159758894 CCCTAGCTGCAGCAGAGGGATGG - Intronic
966863342 3:184242568-184242590 CCAGAGCTGCAGCAGGATGACGG + Exonic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967184355 3:186931962-186931984 CACGATCTGCAGCGGGGAGATGG + Intronic
968228075 3:196988414-196988436 CATGCTCTGCTGCAGGGCGAAGG + Intergenic
969597184 4:8156193-8156215 CCTGAGCTGGGGCAGGGGGTGGG - Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970791482 4:19862950-19862972 CCTGTCCTGGGGCAGGGGGAGGG - Intergenic
971867539 4:32191391-32191413 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
971878768 4:32340557-32340579 CCTGAATTCCAGCTGGGGGAGGG - Intergenic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
976096451 4:81513318-81513340 CCTGAGCTATAGCAGAGGGAGGG - Intronic
978602793 4:110446237-110446259 CCTGAACTTCTGCAGTGGGAGGG - Intronic
980653178 4:135747939-135747961 CCTGTTGTGGGGCAGGGGGAGGG - Intergenic
981739325 4:147985594-147985616 TTTGCTCTGCAGCAGGGGAAAGG - Intronic
982131217 4:152230427-152230449 CCAGGTTTGCTGCAGGGGGAAGG - Intergenic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
983451318 4:167914546-167914568 CCTGTTGTGGGGCAGGGGGAGGG + Intergenic
984853878 4:184176559-184176581 ACTGAACTGCAGGAGGGAGAAGG + Intronic
985311755 4:188609242-188609264 TCTGTCGTGCAGCAGGGGGAGGG + Intergenic
985647664 5:1092674-1092696 CCTGCTCTGAAGCCGGGCGACGG - Intronic
986242774 5:5976349-5976371 CCTGCTGTGCAGCACCGGGAGGG + Intergenic
986528845 5:8712620-8712642 CCTGTTGTGGAGCGGGGGGAGGG - Intergenic
986561108 5:9061590-9061612 CCTGAGCTGCGGCAGGAGAAAGG + Intronic
987163237 5:15166878-15166900 CCTGTCCTGCATCGGGGGGAGGG + Intergenic
987196898 5:15536018-15536040 CCTGAGCTGGAGCAGGTGGGAGG - Intronic
989718956 5:44502283-44502305 TCTGATCTGCAATAGGGGAAGGG - Intergenic
990776164 5:59308640-59308662 CCTGTTCTGGTGCAGGGGGTAGG + Intronic
991544235 5:67763529-67763551 CCTGATGTGGAGTGGGGGGAGGG + Intergenic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
994825007 5:104702029-104702051 CCTGTTGTGGAGTAGGGGGAGGG - Intergenic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999080578 5:148839656-148839678 TATGATCTGCAGCAGTGTGATGG - Intergenic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
1000334071 5:160228994-160229016 GCTGACCTGGAGCATGGGGAAGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002159285 5:177305536-177305558 CCAGAGCTGCAGCTGGTGGAAGG + Intronic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1002322298 5:178383142-178383164 CCAGAGCTGGAGGAGGGGGAGGG - Intronic
1004840336 6:19576746-19576768 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
1006301666 6:33196598-33196620 CCTGTACCGCTGCAGGGGGAAGG + Exonic
1007082119 6:39115011-39115033 CCTGACTGGCAGCAGGGGGTTGG + Exonic
1007217833 6:40254293-40254315 CCTGAACTGCAGCAGGAGAGAGG - Intergenic
1007390843 6:41548683-41548705 GCTGGTTCGCAGCAGGGGGAGGG - Intronic
1007780971 6:44254564-44254586 CCAGCTCTGCAGCAGGGGATTGG - Exonic
1008763442 6:54881911-54881933 CCTGCCGTGCGGCAGGGGGAAGG - Intronic
1010029389 6:71257361-71257383 CCGCATCTGCAGCAGGCAGAAGG + Intergenic
1010191413 6:73201028-73201050 CCTGAGCTGCAGCAAGGGGAGGG - Intergenic
1010351777 6:74883432-74883454 CCTGTTGTGGGGCAGGGGGAGGG - Intergenic
1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG + Intergenic
1013398459 6:109768029-109768051 GCAGATCTGAAGCAGAGGGATGG + Intronic
1014097327 6:117474562-117474584 CCTGTTGTGGGGCAGGGGGAGGG + Intronic
1015179477 6:130346251-130346273 CATGAGCTGAAGCAGGGTGAGGG + Intronic
1016562811 6:145416042-145416064 CATGATCTGCAGCTGGGAGTCGG - Intergenic
1017306462 6:152923738-152923760 CCTGTTGTGGAGTAGGGGGAGGG - Intergenic
1017488654 6:154925128-154925150 CCTGCTCTGTAGCAAGGGCATGG + Intronic
1018596606 6:165487782-165487804 CATGAACTGCATCAGTGGGAGGG - Intronic
1018630442 6:165817349-165817371 CCTGGCTTGCAGCAAGGGGAGGG + Intronic
1018988831 6:168658123-168658145 CCAGATCTGCAGCTGGGGCCAGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020130451 7:5556225-5556247 CCTGGCCTGCAGCAGGCAGAGGG - Intronic
1020468106 7:8504051-8504073 CCTGAAATGAAGCAGGGGCAGGG - Intronic
1023083399 7:36546505-36546527 CCAGATCTCCAGCAGGGGAGAGG + Intronic
1023401491 7:39795096-39795118 CCTGCACAGCAGCAGGGGTAGGG + Intergenic
1023897797 7:44448690-44448712 CCTGAGCTGGAGCAGGGGTCTGG - Intronic
1024186084 7:46949414-46949436 CCTCACCTCCAGCAGAGGGAGGG + Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1026017336 7:66681856-66681878 CCCGATGCGCAGCAGCGGGAGGG - Intronic
1028135604 7:87220272-87220294 CCGGAACTGCAGCAGGAGTACGG + Intronic
1028593917 7:92528262-92528284 CCTGATCTTCAGCCTGGGGTCGG - Intronic
1029528221 7:101108508-101108530 GCAGCTCTGCAGCAGGTGGAAGG - Intergenic
1029736553 7:102468702-102468724 CCTGAACAGCAGCATGGGGATGG + Intronic
1030112550 7:106039003-106039025 CTTGGTCTGCAGCGGGGGAATGG + Intergenic
1030889513 7:114982176-114982198 CCTGATGTGCAGAATGGGGCAGG + Intronic
1031122607 7:117738740-117738762 TCTGATGTGCAGCAGGTGGTGGG + Intronic
1031991787 7:128203284-128203306 ACTGATCTGAAACAGGGGCAGGG + Intergenic
1032075996 7:128836476-128836498 CCAGAGCTGGAGGAGGGGGACGG - Intronic
1032325218 7:130921730-130921752 CCTGCTCTGTCGCAGGGGCAGGG + Intergenic
1032388215 7:131538935-131538957 CATGGTCTGCTGCAGGGGAAGGG - Intronic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1034405707 7:150901252-150901274 CCTGCTCTGGAGCTGGGGGCAGG - Intergenic
1035123577 7:156590618-156590640 CCAAATCTGCAGCAGGAGAAGGG + Intergenic
1035549071 8:506304-506326 CCAGCTCGGCAGCGGGGGGAGGG + Intronic
1035905769 8:3508350-3508372 CCTGTTATGGGGCAGGGGGAGGG + Intronic
1036558728 8:9883854-9883876 CCTAATCAGCAGCAGGAGGCAGG + Intergenic
1036685059 8:10904177-10904199 CCTGGTCTGCACCAGGGAAAGGG - Intronic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1038058057 8:23880684-23880706 CGTGATCAGCATCAGGGGGATGG + Intergenic
1038214102 8:25545855-25545877 TCTGATCTTCAGCATGGGGAGGG - Intergenic
1039443419 8:37611457-37611479 CCTGCTCTGCTCCAGGGTGAAGG - Intergenic
1039508135 8:38067157-38067179 TCTGATTTGCAGCTGGGGGTTGG - Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1045789040 8:105959283-105959305 CCTGTTGTGGGGCAGGGGGAGGG + Intergenic
1047402723 8:124559632-124559654 CCTGATGTTCAGCTGGGGCAGGG + Intronic
1049309166 8:141924293-141924315 CCTGGTCTGCAGCATGGAGGTGG - Intergenic
1049433894 8:142577449-142577471 CTTGACCTGCAGGACGGGGAGGG - Intergenic
1049729390 8:144168111-144168133 CCTGAGCTGCTGCAGGGGTCAGG - Intronic
1049775447 8:144401789-144401811 CCCTCTCTGCAGCAGGGAGAAGG + Intronic
1050363426 9:4852731-4852753 ACTGGACTGCAGCAGGGTGAAGG - Intronic
1051297402 9:15611120-15611142 CCAGATCAGGAGCAGGAGGAAGG - Intronic
1053617281 9:39781414-39781436 CCAGGTCTGCAGCAGTGGGTTGG - Intergenic
1053672241 9:40378089-40378111 CCTGTTGTGGGGCAGGGGGAGGG + Intergenic
1053875464 9:42540777-42540799 CCAGGTCTGCAGCAGTGGGTTGG - Intergenic
1053897181 9:42753856-42753878 CCAGGTCTGCAGCAGTGGGTTGG + Intergenic
1054236236 9:62560947-62560969 CCAGGTCTGCAGCAGTGGGTTGG + Intergenic
1054266885 9:62926023-62926045 CCAGGTCTGCAGCAGTGGGTTGG + Intergenic
1054383352 9:64518123-64518145 CCTGTTGTGGGGCAGGGGGAGGG + Intergenic
1054512383 9:65998221-65998243 CCTGTTGTGGGGCAGGGGGAGGG - Intergenic
1054550378 9:66595477-66595499 CCAGGTCTGCAGCAGTGGGTTGG + Intergenic
1055530292 9:77177288-77177310 GCTGATCTGCAGGAGGGGGCGGG + Intergenic
1055739981 9:79377487-79377509 CCTGCCCTGCAGCTGGGGGAGGG - Intergenic
1056702795 9:88924855-88924877 CCTGGTCTGTAGCTGGGGGTTGG + Intergenic
1057037103 9:91818924-91818946 CATGACCTGCAGAAGAGGGAGGG - Intronic
1057203504 9:93156611-93156633 CCGTACCTGCAGCAGGGAGAAGG - Intergenic
1057720586 9:97528721-97528743 CCTGCTCTGAAGCCGTGGGAGGG - Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058517924 9:105794576-105794598 CCTAATATTCAGCGGGGGGAGGG + Intergenic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1060497487 9:124129303-124129325 CCTGCTCTGCAGCAGAAAGAGGG + Intergenic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1061497155 9:130981630-130981652 CCTGGGGTGCAGCAGGGGAAGGG - Intergenic
1061528237 9:131186952-131186974 CGTGGTCTACAACAGGGGGAAGG + Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1061872817 9:133529734-133529756 CCAGATCTGGAGCAGGGATAGGG - Intergenic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1062139832 9:134949851-134949873 CCTGCTCTGCATCAGCGTGATGG - Intergenic
1062542152 9:137046266-137046288 CCAGAACTGGAGCAGGGGGAGGG - Intergenic
1203377274 Un_KI270442v1:385647-385669 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1186462646 X:9760592-9760614 CCTGATCAGCAGGATGGGGCAGG + Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187297046 X:18012127-18012149 CCTGATCAGCAGGAGGAGGTAGG + Intergenic
1188613093 X:32123433-32123455 CCAGATCAGCATCACGGGGATGG - Intronic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1189526042 X:41823157-41823179 CCTGATTTTCAGCAGGTGGGAGG - Intronic
1191704380 X:64079008-64079030 CCTGTTGTGCCGTAGGGGGAGGG - Intergenic
1196722196 X:118864847-118864869 CCTCATCTGCTGGAGGGGCAAGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1200034909 X:153320865-153320887 CATGGGCTGCAGCAGTGGGAGGG - Intergenic
1201916313 Y:19185276-19185298 CCTGTTGTGCAGTGGGGGGAAGG - Intergenic