ID: 1197882204

View in Genome Browser
Species Human (GRCh38)
Location X:131178528-131178550
Sequence CTGCCTACCAATTGAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197882204_1197882208 11 Left 1197882204 X:131178528-131178550 CCTGACACTCAATTGGTAGGCAG No data
Right 1197882208 X:131178562-131178584 TGAATGTATGAATGGAGCAGGGG No data
1197882204_1197882207 10 Left 1197882204 X:131178528-131178550 CCTGACACTCAATTGGTAGGCAG No data
Right 1197882207 X:131178561-131178583 ATGAATGTATGAATGGAGCAGGG No data
1197882204_1197882209 12 Left 1197882204 X:131178528-131178550 CCTGACACTCAATTGGTAGGCAG No data
Right 1197882209 X:131178563-131178585 GAATGTATGAATGGAGCAGGGGG No data
1197882204_1197882210 16 Left 1197882204 X:131178528-131178550 CCTGACACTCAATTGGTAGGCAG No data
Right 1197882210 X:131178567-131178589 GTATGAATGGAGCAGGGGGCAGG No data
1197882204_1197882206 9 Left 1197882204 X:131178528-131178550 CCTGACACTCAATTGGTAGGCAG No data
Right 1197882206 X:131178560-131178582 AATGAATGTATGAATGGAGCAGG No data
1197882204_1197882205 3 Left 1197882204 X:131178528-131178550 CCTGACACTCAATTGGTAGGCAG No data
Right 1197882205 X:131178554-131178576 TTGTTGAATGAATGTATGAATGG No data
1197882204_1197882212 21 Left 1197882204 X:131178528-131178550 CCTGACACTCAATTGGTAGGCAG No data
Right 1197882212 X:131178572-131178594 AATGGAGCAGGGGGCAGGCTGGG No data
1197882204_1197882211 20 Left 1197882204 X:131178528-131178550 CCTGACACTCAATTGGTAGGCAG No data
Right 1197882211 X:131178571-131178593 GAATGGAGCAGGGGGCAGGCTGG No data
1197882204_1197882213 24 Left 1197882204 X:131178528-131178550 CCTGACACTCAATTGGTAGGCAG No data
Right 1197882213 X:131178575-131178597 GGAGCAGGGGGCAGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197882204 Original CRISPR CTGCCTACCAATTGAGTGTC AGG (reversed) Intergenic
No off target data available for this crispr