ID: 1197882207

View in Genome Browser
Species Human (GRCh38)
Location X:131178561-131178583
Sequence ATGAATGTATGAATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197882201_1197882207 22 Left 1197882201 X:131178516-131178538 CCTAGCAGAGGGCCTGACACTCA No data
Right 1197882207 X:131178561-131178583 ATGAATGTATGAATGGAGCAGGG No data
1197882204_1197882207 10 Left 1197882204 X:131178528-131178550 CCTGACACTCAATTGGTAGGCAG No data
Right 1197882207 X:131178561-131178583 ATGAATGTATGAATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197882207 Original CRISPR ATGAATGTATGAATGGAGCA GGG Intergenic
No off target data available for this crispr