ID: 1197883876

View in Genome Browser
Species Human (GRCh38)
Location X:131197508-131197530
Sequence ATGCCCTTCTGGAAGAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197883874_1197883876 0 Left 1197883874 X:131197485-131197507 CCAAAAGGGAGGGTGTTTGTGAA No data
Right 1197883876 X:131197508-131197530 ATGCCCTTCTGGAAGAATAGAGG No data
1197883873_1197883876 1 Left 1197883873 X:131197484-131197506 CCCAAAAGGGAGGGTGTTTGTGA No data
Right 1197883876 X:131197508-131197530 ATGCCCTTCTGGAAGAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197883876 Original CRISPR ATGCCCTTCTGGAAGAATAG AGG Intergenic
No off target data available for this crispr