ID: 1197886845

View in Genome Browser
Species Human (GRCh38)
Location X:131227250-131227272
Sequence CTTCCTCCCATTAGGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197886840_1197886845 -1 Left 1197886840 X:131227228-131227250 CCAACTTAATATCCTGCCTTAAC No data
Right 1197886845 X:131227250-131227272 CTTCCTCCCATTAGGGAGTCAGG No data
1197886839_1197886845 0 Left 1197886839 X:131227227-131227249 CCCAACTTAATATCCTGCCTTAA No data
Right 1197886845 X:131227250-131227272 CTTCCTCCCATTAGGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197886845 Original CRISPR CTTCCTCCCATTAGGGAGTC AGG Intergenic
No off target data available for this crispr