ID: 1197891462

View in Genome Browser
Species Human (GRCh38)
Location X:131274379-131274401
Sequence CTCCTTTCCTTGGGGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197891462 Original CRISPR CTCCTTTCCTTGGGGAAAAG AGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901391880 1:8951454-8951476 GTCCTCTCCTTGTGGAGAAGGGG + Intronic
902739033 1:18421600-18421622 CTCTTTTTCTTAGGGGAAAGGGG - Intergenic
905038321 1:34930944-34930966 ATCATCTCCCTGGGGAAAAGAGG - Intergenic
906724684 1:48035692-48035714 ATCCTCTCCTTGTGTAAAAGAGG + Intergenic
906738658 1:48158686-48158708 CTCCTTTTCTTCTGGTAAAGGGG + Intergenic
906933100 1:50188801-50188823 TTCTTTTCCCTGGGGAAGAGTGG + Intronic
907922711 1:58928562-58928584 CTTCTAGTCTTGGGGAAAAGGGG - Intergenic
908028079 1:59971846-59971868 ACCCTTTTCCTGGGGAAAAGAGG + Intergenic
908098691 1:60768013-60768035 CTCCTTTTCTGGGGGAAAGAAGG + Intergenic
910158891 1:84252685-84252707 CTCATTGCATGGGGGAAAAGGGG + Intergenic
910729085 1:90371314-90371336 ATTCTTTCCTTGGGGGAATGTGG + Intergenic
911151516 1:94600797-94600819 CTCCTCTCCTGGAGGAAAGGAGG + Intergenic
912198113 1:107423901-107423923 CCCCTTCCTTTGGGGAACAGAGG - Intronic
912873136 1:113328120-113328142 CTTCTTTTCTTGGGAAGAAGGGG + Intergenic
912978605 1:114351085-114351107 CTCCCTTCCTTGGGGCTAAAAGG + Intergenic
913055895 1:115159407-115159429 TTTCTTTCCTTGGGGAAGAGAGG - Intergenic
915459486 1:156061271-156061293 CTCCTCTCATTGGGGGTAAGGGG - Exonic
915903615 1:159862947-159862969 CTCCTTCCCTGGGGGAAGTGGGG + Intronic
916436257 1:164780596-164780618 TGCCTTCCCTTGGGGAAATGAGG - Intronic
916889029 1:169098469-169098491 CTCCTTTGATTGGGACAAAGGGG - Intergenic
917108063 1:171515080-171515102 CATCATTCCTTGGGGGAAAGGGG - Intronic
917606635 1:176637935-176637957 CCCTTTTCCTTTGGGAAAGGAGG + Intronic
919557839 1:199083055-199083077 CTCCTTTCCCCTGGGAAGAGGGG - Intergenic
919911637 1:202114647-202114669 CCCCTTTCCTTGGGGGAAAGGGG - Intergenic
921110426 1:212031225-212031247 CTCCTTCCCCCTGGGAAAAGAGG - Intronic
922576134 1:226661900-226661922 GCCCTTTCCTTGTGGAAAGGTGG - Intronic
923122956 1:231010547-231010569 CTTCTTCCCTTGGAGAAAAAAGG - Intergenic
923129696 1:231064694-231064716 CTCCTTTTCTTTGGGAGCAGAGG + Intergenic
923880548 1:238099496-238099518 CTCTTTTACTTGGCTAAAAGTGG - Intergenic
924073152 1:240304446-240304468 CACCTTTCCCTGGGCACAAGTGG + Intronic
1062942873 10:1438035-1438057 CTCCTCTCCTTTGGGCAGAGTGG + Intronic
1066388009 10:34957067-34957089 CTCCTTTCCCTGGGTGTAAGTGG - Intergenic
1068257499 10:54532374-54532396 CTATTTTGCTTTGGGAAAAGAGG - Intronic
1068313370 10:55308692-55308714 CTACTTACCTTAGTGAAAAGAGG + Intronic
1069457257 10:68562495-68562517 ATCCCTTAATTGGGGAAAAGGGG - Intronic
1070468456 10:76750068-76750090 CTACATTCCTGGGGGAAAGGAGG + Intergenic
1070587896 10:77780196-77780218 CTCCTTTCCAGGGAGAGAAGAGG - Intergenic
1070989135 10:80715943-80715965 CTCCCTTCCTGGTGGAGAAGGGG + Intergenic
1072596145 10:96873975-96873997 CTCTCTTGCTTGTGGAAAAGAGG + Intronic
1073024330 10:100475788-100475810 CCCCTTTGCTTTGGGGAAAGGGG - Intronic
1073739793 10:106393312-106393334 CTCTTTTCCATGGGGATAAATGG + Intergenic
1075008286 10:118846150-118846172 ATCCATTCCATGGGGAAAAAGGG + Intergenic
1075590165 10:123685349-123685371 CTCCTTTCGTTGATGAGAAGAGG - Intronic
1076208892 10:128625122-128625144 CTCCTTGCCTTGGGGAGAGTGGG + Intergenic
1076322181 10:129591388-129591410 CTCCTTTCCTGGGGAGACAGAGG - Intronic
1076519088 10:131068649-131068671 CTCCATTCCTTGGAGAACAGAGG - Intergenic
1077262107 11:1628206-1628228 CTCCTTCCCTCGGGTACAAGAGG - Intergenic
1077270185 11:1673575-1673597 TTCCTTCTCTTGGGGGAAAGCGG + Intergenic
1078191739 11:9096759-9096781 CTCCTTCCCTTGCCCAAAAGAGG + Intronic
1079116839 11:17645549-17645571 CTCCTTACCTGGGGGGACAGGGG - Exonic
1079779789 11:24587067-24587089 CTACTTTCCTTGCAGAAAATTGG + Intronic
1079800192 11:24859752-24859774 CTCCTTTGGCTGGGGGAAAGGGG - Intronic
1080416098 11:32071187-32071209 CTCCTGTCCTTGGAGTTAAGGGG + Intronic
1080683630 11:34497680-34497702 CCCCTTGCCTTGTGGAAAGGTGG + Intronic
1081644178 11:44778311-44778333 CCCCTTTCCTTGGGGCCAAGAGG + Intronic
1081777387 11:45684903-45684925 CGAGTCTCCTTGGGGAAAAGCGG + Intergenic
1082822388 11:57552845-57552867 AACTTTTCCTTGGGCAAAAGAGG + Intronic
1083131371 11:60626040-60626062 TTCATTTCCTTTGGTAAAAGAGG - Intergenic
1085016774 11:73178958-73178980 CTCCTGCCCTGGGGGAAGAGGGG - Intergenic
1086944890 11:92835200-92835222 CTCCTATTCTTGGGGACAAATGG - Intronic
1087345359 11:96964913-96964935 CTCCTTTCCTCAGGCAGAAGGGG - Intergenic
1087389976 11:97519622-97519644 CTCCTTTCTTTTTGCAAAAGCGG + Intergenic
1089170156 11:116506255-116506277 GTCTTTTCTTTGGGGAAAAATGG - Intergenic
1089394376 11:118126352-118126374 CTTCCTTCCTTGTGAAAAAGGGG - Intergenic
1089981842 11:122779253-122779275 CTCCTTTCCTTGCTGTGAAGTGG - Intronic
1090379145 11:126313053-126313075 CTCCTTTACCTGGGGAAGAAGGG + Intronic
1091207205 11:133830007-133830029 CTCTTCTCTTTGGAGAAAAGGGG + Intergenic
1092955966 12:13550288-13550310 CTCCCCTCCTTGGGGAATGGTGG - Exonic
1093210608 12:16303678-16303700 CTCCGGACCTTGGAGAAAAGTGG + Intergenic
1096580161 12:52579901-52579923 CTCTGATCCCTGGGGAAAAGTGG + Intergenic
1098365421 12:69698789-69698811 TTCATTTCCTTAGGGAAAATAGG - Intronic
1099130368 12:78821589-78821611 CTTCTTTCCATTGGTAAAAGAGG + Intergenic
1099228750 12:79999387-79999409 CTTATTTCCATGGGGAAAATTGG - Intergenic
1100402978 12:94248273-94248295 CTCTCTTCCATGGGGAAAATGGG + Exonic
1100953113 12:99875019-99875041 CTCCTGGCCTTGGGGTAAAGAGG + Intronic
1101443376 12:104719917-104719939 CCCATTTCCTGGAGGAAAAGCGG + Intronic
1102077820 12:110073883-110073905 CTCATTTCTGTTGGGAAAAGGGG + Intergenic
1102178731 12:110895513-110895535 CTCCTTCCCTTTGGGAGAAGTGG + Intronic
1103520871 12:121536525-121536547 CCCCTTTCCTTAGAGAGAAGAGG - Intronic
1103749182 12:123147817-123147839 CTTCTTTCTCTGGGAAAAAGGGG + Intronic
1106415526 13:29543217-29543239 CTACTTTCATGGGGGAAAAAAGG + Intronic
1106987070 13:35366666-35366688 CTGCTTACATTGGGGGAAAGAGG - Intronic
1107545317 13:41428524-41428546 CTCGTTTCCAGGGGGAAGAGGGG + Intergenic
1108215971 13:48184866-48184888 TTCCTTCCCTTGAAGAAAAGGGG + Intergenic
1111252311 13:85618568-85618590 CTGCTTTCCATAAGGAAAAGTGG - Intergenic
1113520978 13:110940714-110940736 TTAATTTCCTAGGGGAAAAGGGG + Intergenic
1114559968 14:23582515-23582537 CCCTTTTGCTTGGAGAAAAGGGG - Intergenic
1115369557 14:32596816-32596838 TTCCTTCCCTTGGGAAAAGGTGG + Intronic
1115661068 14:35494675-35494697 CTCTTCTGTTTGGGGAAAAGGGG + Intergenic
1117003453 14:51394815-51394837 CTCCTTTCCTGAGGGACATGGGG + Intergenic
1117309383 14:54506772-54506794 CTCCTTTCCTAGAGGGAAAGTGG - Intergenic
1117424030 14:55577304-55577326 CTCCATTACTTGGGTGAAAGTGG + Intronic
1118787235 14:69056051-69056073 CTGTTTTCATTTGGGAAAAGTGG - Intronic
1119272144 14:73316415-73316437 TTCCTTTCCTGGAGGAACAGGGG + Exonic
1119345726 14:73922222-73922244 CTCCTTTATTTGGGAAAAATGGG + Intronic
1120489188 14:85155105-85155127 CTACTTTCCTTGGGGCAACAAGG - Intergenic
1122940046 14:104977182-104977204 CCCCACTCCTTGGGGAAAACAGG - Intronic
1124631956 15:31343065-31343087 CTCCTGTGCTTGGGGAGAGGAGG + Intronic
1124637544 15:31374637-31374659 CTCCCTGCCTTGGGGAACGGTGG - Exonic
1125547820 15:40520124-40520146 GTCCTTTCCTTGGAGGAAACTGG + Intergenic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1128304793 15:66591241-66591263 CTCCTCCCCTTTGGGGAAAGGGG - Intronic
1128887875 15:71305043-71305065 CCTCTTTCCCTGGTGAAAAGTGG + Intronic
1129833429 15:78685646-78685668 CTCCCGTCCTGGGGGAAAAATGG + Intronic
1131525125 15:93146494-93146516 CGCCTCTCCCTGGGGAGAAGGGG + Intergenic
1132484070 16:181226-181248 CGCCTTTCCTTGGGGAGGGGCGG - Intergenic
1132485327 16:187354-187376 CTCCTTTCCTTGGAGACAGTTGG + Intergenic
1132504770 16:302247-302269 GTCCTTTCCTTGGGGGACTGTGG + Intronic
1133098779 16:3466555-3466577 CTCCTGTCTTTGGGGAACAGGGG - Intronic
1133101405 16:3482328-3482350 CTCATTTCCTTGGGGAGTGGGGG + Intronic
1133263156 16:4565358-4565380 CTCCTGTCCTGGGGAAGAAGGGG - Intronic
1135669752 16:24365332-24365354 CTCCTACTCTTGGGGACAAGTGG + Intergenic
1136711767 16:32243328-32243350 CTCCTTTCCTTGGAGAAGTCAGG + Intergenic
1136756149 16:32686079-32686101 CTCCTTTCCTTGGAGAAGTCAGG - Intergenic
1136811964 16:33184294-33184316 CTCCTTTCCTTGGAGAAGTCAGG + Intergenic
1136818440 16:33294374-33294396 CTCCTTTCCTTGGAGAAGTCAGG + Intronic
1136825004 16:33350907-33350929 CTCCTTTCCTTGGAGAAGTCAGG + Intergenic
1136830070 16:33449678-33449700 CTCCTTTCCTTGGAGAAGTCAGG + Intergenic
1137914479 16:52414096-52414118 CTCCCTTCTTACGGGAAAAGGGG - Intergenic
1138099442 16:54240680-54240702 CTTCTTTCCTTGGGGAATAATGG - Intergenic
1139193848 16:64895567-64895589 CTCTTTTCTTTGGTGAAAAGGGG + Intergenic
1141199069 16:81883249-81883271 TTCCTATCCTCGGGGAAAGGGGG - Exonic
1141960797 16:87406668-87406690 CCCCCTTCCTTGGTGAACAGTGG + Exonic
1202990542 16_KI270728v1_random:7264-7286 CTCCTTTCCTTGGAGAAGTCAGG + Intergenic
1203058287 16_KI270728v1_random:946431-946453 CTCCTTTCCTTGGAGAAGTCAGG - Intergenic
1144735415 17:17552909-17552931 CTCCTGGCCTGGGGGAAAGGGGG - Intronic
1145863984 17:28228388-28228410 CTCCTCTGCTCGGGGAAAGGGGG - Intergenic
1145990685 17:29077681-29077703 CAGCTTTCCTGGTGGAAAAGAGG + Exonic
1146977294 17:37124926-37124948 TTCCTTATCTTGGTGAAAAGTGG - Intronic
1147168015 17:38603639-38603661 CACCCTGCCTTGGGGACAAGAGG - Intronic
1147728737 17:42583370-42583392 CTCCTTGTCTTGGGAACAAGGGG + Intronic
1148543908 17:48502424-48502446 TTTCTCTCCTGGGGGAAAAGAGG - Intergenic
1148712607 17:49692747-49692769 CTCCTTTCCTTTAGCAAAAGAGG + Intergenic
1149569680 17:57663503-57663525 CTTCTGACCTTGGGGAGAAGAGG + Intronic
1150779513 17:68109316-68109338 TTCCTTACTTTGGGAAAAAGAGG + Intergenic
1150864212 17:68832698-68832720 CTCCTCTCCTTGAGGAATTGGGG + Intergenic
1151750274 17:76033219-76033241 CCCCTTTCCCTGGGAGAAAGGGG + Intergenic
1153255869 18:3170638-3170660 GTCCTTTCTTTGGTGAAAAGAGG - Intronic
1153322623 18:3788134-3788156 CCCCTCTTCTTAGGGAAAAGAGG - Intronic
1153883838 18:9445640-9445662 TTCCTTTCCTTTGGGTAAATGGG + Intergenic
1155826530 18:30450970-30450992 CTATTTTTCTTGGGGAAAATGGG + Intergenic
1156655869 18:39285288-39285310 CTCCTTGCCTTAGAGAATAGAGG + Intergenic
1156796192 18:41049140-41049162 CTCCTTTCTTTGCAGAAATGTGG - Intergenic
1157469556 18:47978785-47978807 AGCCTTTCCTAGGAGAAAAGGGG - Intergenic
1160677344 19:398441-398463 CCCCTTTCCTTTGGCAAATGTGG - Intergenic
1162457753 19:10796223-10796245 CTCCTGACCTTGTGGAAACGGGG + Intronic
1163585837 19:18162952-18162974 CGCCTTTCCTGGGGGAGGAGAGG - Exonic
1167471019 19:49676628-49676650 CTCATTACCTGGGGGAAAAACGG - Intronic
1168430584 19:56276319-56276341 CTCCTTTGTCTGGGGAAGAGAGG + Intronic
1168726372 19:58584594-58584616 CTCCTTTCCTTGGGGGAGTGAGG + Intergenic
925400137 2:3566738-3566760 CTCCTTCCCGAGGGGACAAGAGG - Intergenic
925588538 2:5487406-5487428 CTCCTTTCCTCAGGCAGAAGGGG - Intergenic
925686828 2:6481791-6481813 CTCCTTTCTTTGGGGACATCAGG - Intergenic
926636866 2:15189592-15189614 CCCCTTTCCTTTGGAAGAAGTGG - Intronic
927053438 2:19350667-19350689 CTCTTCTCCTTGGGGCAAGGCGG - Intergenic
928932329 2:36637241-36637263 CTCCTTTCCTTAAGCAGAAGGGG - Intronic
931964283 2:67516228-67516250 CTCCCTTCCCTGGGGCAAAACGG - Intergenic
932648742 2:73532467-73532489 CTCCTCTGTTTGTGGAAAAGAGG - Intronic
932855795 2:75232804-75232826 TTTCCTTCCTTGGGGAAAAAAGG + Intergenic
933114782 2:78454762-78454784 CACATTTCCTTGGGGATAACTGG + Intergenic
933765448 2:85705555-85705577 CTCCATTCTTTGGAGAAAGGTGG - Intergenic
937267011 2:120623104-120623126 CTCCTTTCCCTGGGAAGAGGGGG + Intergenic
937698588 2:124837556-124837578 CCCCTTTCCCTGGATAAAAGAGG - Intronic
937855052 2:126666192-126666214 CTCCTTCCCCGGGGGAAGAGTGG - Intronic
939862526 2:147436806-147436828 CTACTTTCCAAGGGGAAAAATGG + Intergenic
940219388 2:151335858-151335880 CTCCTTTCCCTGTGGAAGACTGG + Intergenic
943369654 2:187001741-187001763 CTCCTTTCCAGGGAGAAAGGAGG - Intergenic
944046159 2:195414181-195414203 CTGCTTTTCTTGGGCACAAGGGG - Intergenic
946156193 2:217808241-217808263 CTCCTGTCCCTGGGGAATGGGGG - Intronic
946390779 2:219415822-219415844 CTCAGTTCCTTGGTGAAAAGAGG - Intergenic
946458477 2:219848890-219848912 CACTTTTCCTTTGGGAAAAGTGG - Intergenic
947728668 2:232416429-232416451 CTCCTTTCCTTGGTGGGCAGGGG - Intergenic
947873751 2:233454664-233454686 TTCTCTTCCTTGGGGAAAACTGG - Intronic
948475440 2:238216073-238216095 CTCCTCTGCCTGGGGAAGAGTGG - Intergenic
948774665 2:240277804-240277826 CTCCTTTCCTCAAGCAAAAGGGG - Intergenic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
1168899934 20:1354807-1354829 CTCCTTTCCTTAGGCAGAAGGGG + Intronic
1169743269 20:8918120-8918142 ATCCTATCCATGGGGAAAATGGG - Intronic
1172767211 20:37357165-37357187 CCCCTGTCCTTGGGGAGCAGGGG + Intronic
1175610382 20:60346473-60346495 CTCCTTTCCTCATGGAGAAGAGG - Intergenic
1176905317 21:14493373-14493395 CTATTGTCCTTGGGGAAAATGGG - Intronic
1177563586 21:22788630-22788652 TCCCTAACCTTGGGGAAAAGTGG - Intergenic
1178040407 21:28634410-28634432 GCCCTTTCCTTGGGGAAAATTGG - Intergenic
1179319324 21:40274547-40274569 CCCCTTTCCTTGGGGAAAGATGG + Intronic
1181476047 22:23168435-23168457 CTCCTCTCCTGAGGGAGAAGCGG + Intergenic
1181679819 22:24486258-24486280 CTCCTCTCCTTAGGGACATGTGG + Intergenic
1181889100 22:26045972-26045994 CACCTCTCATTGGGGAAAAATGG + Intergenic
1181965070 22:26650766-26650788 ATCCCTTCCTAGGGGAAAAAAGG + Intergenic
1182465676 22:30514726-30514748 CTCCCTTCCTTGGGGAAGTAGGG - Intergenic
1184016817 22:41792476-41792498 CTCCATTCCTGGGGGAATAGAGG - Intronic
949504572 3:4714828-4714850 CTCCCTGCCTTGGGGAAGAAAGG + Intronic
950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG + Intronic
950376196 3:12574329-12574351 ATCATTTTCTTGGGGAGAAGTGG + Intronic
950484486 3:13265032-13265054 CTGCTTTCCAGGGGGAGAAGGGG - Intergenic
950740426 3:15046741-15046763 CGCCTTCCCTGGGAGAAAAGTGG - Exonic
951964961 3:28371820-28371842 CTCCAGGCCTAGGGGAAAAGAGG + Intronic
952912662 3:38204074-38204096 CTCCTCTACTTGTGGAAAGGGGG - Intronic
953251121 3:41246545-41246567 CTCCTCTCCTCAGGGAAGAGCGG - Intronic
954375574 3:50192563-50192585 CTCTCTGCCTTGGGGGAAAGTGG - Intronic
956256743 3:67291320-67291342 CTCCTTCCATTGAGGGAAAGGGG - Intergenic
958659150 3:97043088-97043110 TTTCTTTCCTGGGGGAAAAAAGG - Intronic
959395699 3:105835131-105835153 TTCTTTTCATTGGTGAAAAGCGG + Intronic
961191122 3:124962752-124962774 GTCCTTTCCCTGGGGAATTGTGG - Intergenic
961252479 3:125519305-125519327 TTCATTTGCTTGAGGAAAAGGGG - Intronic
961981319 3:131082052-131082074 CTGCTTTGCTTGGAGGAAAGTGG + Intronic
962371888 3:134827708-134827730 CTCCTTTCCCTGGGGAGCTGGGG + Intronic
962497995 3:135962029-135962051 CTTCTTTTTCTGGGGAAAAGGGG + Intergenic
963215715 3:142745267-142745289 TTCCTTTCCTGGGGGAAGGGTGG + Intronic
964496836 3:157300281-157300303 CTCTATTCCTGGGGGAACAGAGG - Intronic
964692407 3:159465075-159465097 CTCCTTTACTTGTGGAGAGGAGG - Intronic
964811004 3:160664784-160664806 CTCCTTTCCTAGGCGCACAGTGG - Intergenic
964960513 3:162417886-162417908 ATCCTTTCCTCAGGGGAAAGGGG + Intergenic
966089440 3:176114823-176114845 CTGCTTTCTTGGTGGAAAAGTGG + Intergenic
966143589 3:176785258-176785280 CTCCTATCCTTGGAGAGAAATGG - Intergenic
966910848 3:184559211-184559233 CTCATTTCTTTGGGGATAGGTGG - Intronic
968819348 4:2837823-2837845 TGCCTGTCCTTGGGGAAGAGGGG + Exonic
971076301 4:23153138-23153160 CTCCTTTGCCTGCAGAAAAGAGG - Intergenic
973342979 4:49025566-49025588 GTCCCATCCCTGGGGAAAAGGGG - Intronic
977332927 4:95660813-95660835 CTAGTTTCCTTGGAGAAAGGAGG + Intergenic
980896611 4:138866473-138866495 GTCCTCACCTTGGGGCAAAGCGG - Intergenic
981588938 4:146335358-146335380 CTGCTTGACTTGGGGACAAGGGG - Intronic
982764555 4:159330024-159330046 TTCCTTTCCTTGGGAAGGAGTGG - Intronic
982818379 4:159915579-159915601 CTCTTTTCTTTGAGGATAAGAGG - Intergenic
983558809 4:169081478-169081500 CTCTTTGCCTTAAGGAAAAGGGG - Intergenic
984397345 4:179218745-179218767 GTCTTTTCCTGGGGGATAAGTGG + Intergenic
984893215 4:184512011-184512033 ATCCTTGCTTTGGAGAAAAGTGG - Intergenic
986293174 5:6416622-6416644 CCCTTGACCTTGGGGAAAAGAGG + Intergenic
987520571 5:18977288-18977310 ATACTTTCCTTGGGGTAAACTGG + Intergenic
987615554 5:20269370-20269392 ATCTTTTCCTTTGGGAAAAGTGG - Intronic
987699251 5:21375049-21375071 CTCTTTTTCATGGGGAAGAGTGG + Intergenic
987743335 5:21937883-21937905 CTCCTTTTCATGGGGAGAGGAGG + Intronic
988753170 5:34213015-34213037 CTCTTTTTCGTGGGGAAGAGTGG - Intergenic
989192900 5:38688732-38688754 TTCCTTTCCTTGGGGAAGTAGGG - Intergenic
990308518 5:54517277-54517299 CTCCTCTCCTTGAGCAGAAGAGG + Intergenic
991134482 5:63165344-63165366 CTCTGGTCCTTGGGGAGAAGTGG + Intergenic
991749576 5:69786624-69786646 CTCCTTTTCATGGGGAGAGGAGG - Intergenic
991763534 5:69948016-69948038 CTCCTTTTCATGGGGAGAGGAGG + Intergenic
991783792 5:70170113-70170135 CTCCTTTTCATGGGGAGAGGAGG - Intergenic
991801155 5:70366438-70366460 CTCCTTTTCATGGGGAGAGGAGG - Intergenic
991827444 5:70643604-70643626 CTCCTTTTCATGGGGAGAGGAGG + Intergenic
991842763 5:70823076-70823098 CTCCTTTTCATGGGGAGAGGAGG + Intergenic
991876238 5:71170488-71170510 CTCCTTTTCATGGGGAGAGGAGG - Intergenic
992020344 5:72617810-72617832 CTCCTTTCCTCTTGGGAAAGAGG - Intergenic
992171416 5:74105593-74105615 CTCCATTCCTTGAAGAATAGGGG - Intergenic
992333007 5:75737141-75737163 CTGCCTTCCTTGGGGCAATGGGG - Intergenic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993476791 5:88376380-88376402 CTCCTCTCCTTGAGTATAAGTGG + Intergenic
995133943 5:108660306-108660328 CTTCTTTCTTTGCGGAAATGTGG + Intergenic
995182878 5:109245336-109245358 CTCTTTTCCTGAGGGAAAACAGG - Intergenic
995694012 5:114859410-114859432 CTCCTCTGCTGGGGGGAAAGGGG + Intergenic
996024375 5:118628835-118628857 CCCCTTTCCCTGGAGCAAAGGGG - Intergenic
996148111 5:119999971-119999993 TTCCTTTCTTTGGGGGAATGTGG + Intergenic
997254935 5:132421333-132421355 TTCCTTTCCTTGGGAAATAGAGG + Intronic
998452576 5:142246175-142246197 CTCCTTTCCAGAGGGGAAAGGGG + Intergenic
999572626 5:152937841-152937863 CTCTTGTCCTTGCTGAAAAGAGG - Intergenic
999778566 5:154830478-154830500 CTCCATTCCTATGGGTAAAGTGG + Intronic
1000824798 5:166031796-166031818 CTCCTTTAGCTGGGGAAGAGGGG - Intergenic
1001317325 5:170653079-170653101 CTCCTTTCCTTTGGGGTGAGTGG - Intronic
1002259367 5:177983204-177983226 CTCCTTTCCCTGGGGCAACATGG + Intergenic
1003449656 6:6219074-6219096 CTCCTTTACTTGGAGAGGAGAGG + Intronic
1004306234 6:14504275-14504297 TTCCTAGCTTTGGGGAAAAGAGG - Intergenic
1006040850 6:31253494-31253516 CTCTTTTCCTTGTGGATCAGGGG + Intergenic
1007368842 6:41413166-41413188 CTCCTTTTCTTGAAAAAAAGGGG - Intergenic
1008040951 6:46797607-46797629 CTCATTTACTTTGGGACAAGAGG + Intronic
1008101726 6:47398871-47398893 CTCCTCTGCATGGGGAAGAGTGG - Intergenic
1008720604 6:54345626-54345648 CTCCTTTCCTTGATGAAATGGGG + Intronic
1009714398 6:67369898-67369920 CTTGTTTCCTTGGGGAAAGATGG - Intergenic
1010056781 6:71575587-71575609 CTCCCTGCCTCTGGGAAAAGGGG + Intergenic
1010912624 6:81578780-81578802 CTCCTTTCCTTGGCTAGAAAAGG - Intronic
1012143825 6:95656428-95656450 CTTCTTTCTTTGGAGAACAGAGG + Intergenic
1012378240 6:98588430-98588452 CTCCTTTCCTTGGGGGTGAGAGG + Intergenic
1013124783 6:107172362-107172384 CTAGTTTCCTTGGGCAGAAGTGG - Intronic
1013537284 6:111074918-111074940 TTCCTTTCCATGGGGAGAAATGG - Intergenic
1016429078 6:143964149-143964171 CTCATTGCCTTAGGGAACAGAGG - Intronic
1016473283 6:144397960-144397982 CTCCTTGCCTTAGGGCAGAGAGG + Intronic
1017456777 6:154607732-154607754 CTCCTTTCTTTAGGCCAAAGAGG + Intergenic
1018984113 6:168622881-168622903 GTCCTCTCCTTGGAGAAATGTGG - Intronic
1019877721 7:3829577-3829599 CTGCTTTCATTGGAGAAACGAGG - Intronic
1021817102 7:24457916-24457938 CTCCTTCCCTTATGGAAGAGAGG - Intergenic
1021898195 7:25257337-25257359 CTCCACTCTTTGGGGATAAGTGG + Intergenic
1022048709 7:26644241-26644263 CTCCTTCCCCTAGAGAAAAGGGG + Intronic
1022088830 7:27094787-27094809 CAACTTTCCCTGGGGCAAAGTGG + Exonic
1023924092 7:44652506-44652528 CTCATTTCCCTGGGGAAAGAGGG + Intronic
1023929103 7:44694070-44694092 CTCCTCTCCTTGGGACACAGGGG - Intronic
1024023417 7:45391301-45391323 AGCCTTCCCTTGGGGAAATGAGG - Intergenic
1026172477 7:67966191-67966213 CTCCTTACCTGGGTGAAATGGGG - Intergenic
1028106536 7:86885690-86885712 CTACTCTCCTGTGGGAAAAGAGG + Intronic
1028121272 7:87059203-87059225 TTCCTTTGCTTGGAGAACAGGGG - Intronic
1028181542 7:87730467-87730489 CTCTTCTGCTTGAGGAAAAGGGG + Intronic
1029568301 7:101354245-101354267 CTCCTTTCCTTGGTGACATTTGG - Intergenic
1030292097 7:107883107-107883129 ATTCTTCCCTTAGGGAAAAGAGG - Intergenic
1030647768 7:112082462-112082484 CTCCTTTACTGGGGGATAATAGG + Intronic
1031313681 7:120231099-120231121 CTTCTTTTATTGGGGGAAAGTGG - Intergenic
1031971067 7:128065587-128065609 CCTCTTTTCTTGGGGAAAATCGG - Intronic
1032142891 7:129349824-129349846 CTGCTTTGTTTTGGGAAAAGGGG + Intronic
1032268394 7:130383806-130383828 CTCCTGTCCTTGGGGGAAGCAGG + Intronic
1034486227 7:151365157-151365179 ATCATTTGCTTGGGGCAAAGTGG - Intronic
1034962706 7:155372599-155372621 CTTCTCTCCCTGGGGAGAAGCGG - Intergenic
1036019627 8:4829832-4829854 CGCTTTACCTTGGGGACAAGGGG + Intronic
1036934134 8:12984535-12984557 CTTCTTTCCTGGGAGAAAAGAGG + Intronic
1038023928 8:23572554-23572576 CTCTTTTCATGGGGGAAAAAAGG + Exonic
1038024330 8:23575605-23575627 CTGCTTGCCCTGGGGAAATGGGG - Intergenic
1038054631 8:23846825-23846847 CTCCTTTGGATGGGGAAATGAGG + Intronic
1038850233 8:31268486-31268508 CTCGTCTCCTGGGGGTAAAGGGG + Intergenic
1040722123 8:50337472-50337494 CTCCTTTCCTTGCAGGAAACGGG - Intronic
1043556679 8:81438769-81438791 CTCCATTTCTAGGGGAAGAGGGG - Intergenic
1045538739 8:103060681-103060703 TACCTTTCCTTAGGGGAAAGAGG + Intronic
1048029890 8:130621304-130621326 CTCCTTTCCTCAGACAAAAGGGG + Intergenic
1048933631 8:139337181-139337203 CTTCATTGCTTGGGGAAAGGAGG + Intergenic
1049423101 8:142525441-142525463 CTCCTGTCCTTGGGGCCACGTGG + Intronic
1049943696 9:574168-574190 CCCCTTTCCTAAGGGAAGAGTGG - Intronic
1050201891 9:3154149-3154171 CTCCTATCCATGTGAAAAAGAGG - Intergenic
1051271637 9:15361023-15361045 CTGGTTTCTATGGGGAAAAGGGG - Intergenic
1052355708 9:27502987-27503009 CCCTTTTTCTTGGGGGAAAGAGG + Intronic
1053174725 9:35914530-35914552 CTCCTGCCCTTGGGGACAATAGG - Intergenic
1054800846 9:69346916-69346938 CACCTTCTCATGGGGAAAAGGGG + Intronic
1055180177 9:73377798-73377820 CTTCTTTCCCTTGGGGAAAGGGG - Intergenic
1055277816 9:74639775-74639797 CTACTTTCCTGGGGGAGAAGGGG + Intronic
1055762972 9:79629420-79629442 TGCCTTTTCTTGGGGAAATGAGG + Intronic
1056600666 9:88044270-88044292 CCCCTTTCCTGGAGGAAAATGGG + Intergenic
1057319825 9:94002348-94002370 ATCCCATTCTTGGGGAAAAGGGG - Intergenic
1060100122 9:120833158-120833180 CACATTTCCTAGGGGGAAAGAGG + Intronic
1060459590 9:123837706-123837728 TTCCTTTTCTTTAGGAAAAGAGG - Intronic
1061296418 9:129679270-129679292 CTCCATTCCTTGTGGAATACAGG - Intronic
1061974070 9:134059597-134059619 CTCCTTTTCTTGGGGAACAGGGG + Intronic
1062167745 9:135116476-135116498 CTCCTTCCCATGGGCAGAAGGGG - Intronic
1062254979 9:135616575-135616597 CTCTTTTCCCAGGGGAGAAGGGG + Intergenic
1062389395 9:136327949-136327971 CCCCTTGGCTTGGGGGAAAGAGG - Intronic
1187236923 X:17476309-17476331 CTACTTTCCAGGAGGAAAAGGGG - Intronic
1187623629 X:21086242-21086264 CTCCTCTCCCTGTGGAAAGGAGG + Intergenic
1189197530 X:39164963-39164985 CCCATTTCCCTGGGGGAAAGTGG + Intergenic
1189699109 X:43697949-43697971 CTCCACTTCTAGGGGAAAAGTGG + Intronic
1192057136 X:67784620-67784642 GTCTTATCCTTGGGGAAATGAGG - Intergenic
1196898392 X:120360051-120360073 CTTCCTTCCTTTGGGAACAGGGG + Intergenic
1197891462 X:131274379-131274401 CTCCTTTCCTTGGGGAAAAGAGG + Intronic
1198548929 X:137724402-137724424 GTCCTTTCATGGGGGAAAAGAGG - Intergenic
1198664121 X:139002976-139002998 CTCCTTCTGTTTGGGAAAAGTGG + Intronic