ID: 1197898343

View in Genome Browser
Species Human (GRCh38)
Location X:131341532-131341554
Sequence CAGCGTGGGGACCTGGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 221}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197898328_1197898343 18 Left 1197898328 X:131341491-131341513 CCATCTCTTTCCCTTCCCTTACC 0: 1
1: 5
2: 109
3: 985
4: 5684
Right 1197898343 X:131341532-131341554 CAGCGTGGGGACCTGGGCGTGGG 0: 1
1: 0
2: 1
3: 22
4: 221
1197898329_1197898343 8 Left 1197898329 X:131341501-131341523 CCCTTCCCTTACCCTCCTTTACT 0: 1
1: 0
2: 11
3: 201
4: 1803
Right 1197898343 X:131341532-131341554 CAGCGTGGGGACCTGGGCGTGGG 0: 1
1: 0
2: 1
3: 22
4: 221
1197898334_1197898343 -3 Left 1197898334 X:131341512-131341534 CCCTCCTTTACTATTTTGGACAG 0: 1
1: 1
2: 2
3: 18
4: 238
Right 1197898343 X:131341532-131341554 CAGCGTGGGGACCTGGGCGTGGG 0: 1
1: 0
2: 1
3: 22
4: 221
1197898335_1197898343 -4 Left 1197898335 X:131341513-131341535 CCTCCTTTACTATTTTGGACAGC 0: 1
1: 1
2: 0
3: 11
4: 111
Right 1197898343 X:131341532-131341554 CAGCGTGGGGACCTGGGCGTGGG 0: 1
1: 0
2: 1
3: 22
4: 221
1197898332_1197898343 2 Left 1197898332 X:131341507-131341529 CCTTACCCTCCTTTACTATTTTG 0: 1
1: 0
2: 0
3: 23
4: 367
Right 1197898343 X:131341532-131341554 CAGCGTGGGGACCTGGGCGTGGG 0: 1
1: 0
2: 1
3: 22
4: 221
1197898336_1197898343 -7 Left 1197898336 X:131341516-131341538 CCTTTACTATTTTGGACAGCGTG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1197898343 X:131341532-131341554 CAGCGTGGGGACCTGGGCGTGGG 0: 1
1: 0
2: 1
3: 22
4: 221
1197898331_1197898343 3 Left 1197898331 X:131341506-131341528 CCCTTACCCTCCTTTACTATTTT 0: 1
1: 0
2: 1
3: 59
4: 587
Right 1197898343 X:131341532-131341554 CAGCGTGGGGACCTGGGCGTGGG 0: 1
1: 0
2: 1
3: 22
4: 221
1197898330_1197898343 7 Left 1197898330 X:131341502-131341524 CCTTCCCTTACCCTCCTTTACTA 0: 1
1: 1
2: 3
3: 35
4: 610
Right 1197898343 X:131341532-131341554 CAGCGTGGGGACCTGGGCGTGGG 0: 1
1: 0
2: 1
3: 22
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197898343 Original CRISPR CAGCGTGGGGACCTGGGCGT GGG Intronic
900003680 1:29753-29775 CAGGGGCGGGCCCTGGGCGTGGG - Intergenic
900142053 1:1142820-1142842 CTGCGTGGGGACCTGGCTGACGG - Intergenic
900392897 1:2441382-2441404 GAGCGTGGGGGCATGGGGGTGGG + Intronic
900554496 1:3272954-3272976 CATGGTGGGGACCTGGTCATGGG + Intronic
900572213 1:3364255-3364277 CGGCGTGAGGTCCTGGGCGGAGG + Intronic
900865573 1:5266473-5266495 CAGCTTGGGGAGCAGGGAGTTGG - Intergenic
902163644 1:14552392-14552414 GAGGGTGGGGATCTGGGCCTGGG - Intergenic
902214342 1:14924761-14924783 CGGCGTGGGGACCGGGGCTCGGG + Intronic
904771721 1:32884763-32884785 CTGCGTGAGGACCTGGGGGCTGG - Intergenic
906509974 1:46405367-46405389 CAGCGTGGAGTCCTGGCCCTGGG - Exonic
907457470 1:54584799-54584821 CAACGTGGTGAGCTGAGCGTCGG + Exonic
908511123 1:64850725-64850747 CAGCTTGGGGATCTGGGGGAAGG - Intronic
909957723 1:81800833-81800855 GAGCTCGGGGACCTGGGGGTAGG + Intronic
910104733 1:83619359-83619381 CAGAGTAGGGACCTGGGGTTAGG + Intergenic
912430583 1:109626486-109626508 CAGCCTGGAGAGCTGGGGGTGGG + Intronic
912430763 1:109627237-109627259 ATGCCTGGGGACCTGGGCTTGGG + Exonic
913075119 1:115335742-115335764 CTGCTTGGGGATCTGGGCCTTGG + Intronic
915507869 1:156368920-156368942 CAGCTGTGGGACCTGGGGGTGGG - Intergenic
915951057 1:160190304-160190326 CAGTGTGGGGACCGGGGCTGAGG + Intergenic
916717179 1:167455705-167455727 CAGCGCGGGGGCCTGGGGGCGGG - Intronic
917038497 1:170776179-170776201 CAGCGTGGTGCCCTGTGCATAGG - Intergenic
923255637 1:232219271-232219293 GACTGTGGGGTCCTGGGCGTTGG - Intergenic
923543522 1:234907217-234907239 CAGCCTGGTGGCCTGGGTGTGGG + Intergenic
1063130647 10:3173746-3173768 CACCGTGGGGCCCTGGCCCTGGG - Intergenic
1063153279 10:3355735-3355757 GAGTGGGGGGACCTGGGTGTGGG + Intergenic
1063291665 10:4756090-4756112 CAGGGTGGGGAGCTGGGGGAGGG - Intergenic
1063389346 10:5639190-5639212 CCGCGTGGGTACTTGGGGGTGGG - Exonic
1065007742 10:21395321-21395343 CAGGGAGGGGACCAGGGAGTGGG - Intergenic
1066080696 10:31928479-31928501 CAGCGAGGGGCTCTGGGCGCGGG - Intronic
1067196896 10:44127912-44127934 CAGGGTGGGGAGCTGGGGGATGG - Intergenic
1069351326 10:67530837-67530859 CAGCATGGGGACCTTGGGCTTGG - Intronic
1069654221 10:70075857-70075879 GAGGGTGGGGACCTGGGAGCAGG - Intronic
1069724159 10:70566754-70566776 CTGCGTGGGGCCCTGTGGGTGGG - Exonic
1070775883 10:79109573-79109595 CAGTGTGGGGGCCTGGGAGTGGG - Intronic
1072147559 10:92656018-92656040 CAGCGTGGAGTCCTGGTCTTGGG + Intergenic
1072720733 10:97779501-97779523 CAGCAAGGGGACCTGGCCTTGGG - Intergenic
1075594694 10:123720510-123720532 CAGAGTGGGGGCCTGGGTGACGG - Intronic
1075644704 10:124090019-124090041 CAGCCTAGGGACCTGGCCGCAGG + Intronic
1075779082 10:125005418-125005440 CTGTTTGGGGACCTGGGTGTCGG - Intronic
1076384332 10:130045975-130045997 CAGGGTGGGGCTCTGGGCATGGG + Intergenic
1076478769 10:130770199-130770221 CAGCGTGGGGTGTGGGGCGTTGG - Intergenic
1076902829 10:133348148-133348170 CAGCCTGGGGGCCTGGGATTCGG - Intronic
1077010764 11:378311-378333 CAGCCTGGAGCCCTGGGCGGTGG + Intronic
1077405142 11:2379334-2379356 GAGAGTGTGGACCTGGGAGTAGG + Intronic
1077405167 11:2379396-2379418 GAGAGTGTGGACCTGGGGGTAGG + Intronic
1077405179 11:2379427-2379449 GAGAGTGTGGACCTGGGGGTGGG + Intronic
1077424502 11:2467953-2467975 CAGCGTGGGGACCTGCCCAGTGG + Intronic
1077431997 11:2520344-2520366 CAGCGTGGGGCCCTCGGTGTGGG + Intronic
1077458161 11:2693378-2693400 CAGTGTGTGGAGCTGGGCCTGGG + Intronic
1081658617 11:44874266-44874288 CAGCCAGGTGACCTGGGCATGGG + Intronic
1081905202 11:46664873-46664895 CAGCCTGCTGCCCTGGGCGTTGG + Exonic
1081909938 11:46694298-46694320 CACCCTGGGGAGCTGGGAGTTGG - Intronic
1081977224 11:47243254-47243276 CAGCTTGGGGAGCTGGGAGGTGG + Exonic
1081993960 11:47352009-47352031 CAGCCCAGGGACCTGGGCCTGGG - Intronic
1083541802 11:63516436-63516458 GAGAGTGGGGCCCTGGGAGTGGG - Exonic
1084164215 11:67367428-67367450 CAGCGTAGGAATCTGGGAGTTGG - Intronic
1084403076 11:68956126-68956148 CAGGGTGGTGGCCTGGGGGTGGG + Intergenic
1084403093 11:68956156-68956178 CAGGGTAGGGGCCTGGGGGTGGG + Intergenic
1084749421 11:71194345-71194367 AGACCTGGGGACCTGGGCGTGGG + Intronic
1087066692 11:94034082-94034104 AAGCATGGGGACCTGGGAGTTGG + Intronic
1092237915 12:6821570-6821592 CAGGGTGGGGAACTGGACGGTGG - Exonic
1095799036 12:46252337-46252359 CAGGGTGGGGGCCTGGGGGAGGG + Intronic
1099300859 12:80892756-80892778 CAGAGTGGGGGGCTGGGCATGGG + Intronic
1102561053 12:113762542-113762564 CAGCAAGGGGACCTGGGGGTGGG - Intergenic
1102651919 12:114448324-114448346 CAGAGTGGGGACATGAGCGCGGG - Intergenic
1103323310 12:120103992-120104014 CAGCGTGGGGCTCAGGGCCTGGG - Intronic
1104914437 12:132257536-132257558 GGGCGTGGGGACGAGGGCGTGGG - Intronic
1104914442 12:132257550-132257572 GGGCGTGGGGACGAGGGCGTGGG - Intronic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1109630157 13:65034512-65034534 GAGGGTGGGGGCCTGGGGGTGGG + Intergenic
1109715806 13:66220393-66220415 CAGCCTGGGGACCTTGGGTTGGG - Intergenic
1110387982 13:74936847-74936869 CAGGGTGGGGAGCTGGGGGAGGG + Intergenic
1113905764 13:113818500-113818522 CAGCGTGGAGGCCTGGGCTGCGG + Intergenic
1113937522 13:114002176-114002198 CAGAGTGGGGAGGTGGGCGGGGG + Intronic
1114648995 14:24271381-24271403 GAGCCGGGGCACCTGGGCGTTGG + Exonic
1116524562 14:45888876-45888898 CAGCGAGACGCCCTGGGCGTAGG + Intergenic
1119498407 14:75101099-75101121 AAGTGTGGGCAGCTGGGCGTTGG - Exonic
1119778026 14:77260240-77260262 CAAGGTGTGGGCCTGGGCGTGGG + Intergenic
1122306750 14:100771306-100771328 CAGCCTGGGCCCCTGGGCCTTGG - Intergenic
1122396630 14:101437506-101437528 CAGCGTGGGGCACTGTGCATTGG + Intergenic
1123891606 15:24786123-24786145 CAGCGTGGCGGCTTTGGCGTGGG - Intergenic
1124639956 15:31391351-31391373 GAGTGCGGGGACCTGGGTGTGGG + Intronic
1124857002 15:33398866-33398888 CAGCCTGGGTACCTGGGTGCGGG + Intronic
1127804926 15:62510303-62510325 GAGGGTGGGGCCCTGGGCTTTGG + Intronic
1128312688 15:66641351-66641373 CAAGGTGGGGTCCTGGGAGTTGG - Intronic
1130390007 15:83447196-83447218 CGGCCTGGGAAGCTGGGCGTGGG - Intergenic
1132406073 15:101542572-101542594 CAGCGAGGGGGCCTGGGAGGAGG - Intergenic
1132449822 15:101961187-101961209 CAGGGGCGGGCCCTGGGCGTGGG + Intergenic
1132570029 16:640524-640546 CAGCCTGGGGGCCAGGACGTGGG + Intronic
1132571009 16:643982-644004 CAGCGCTGGGGCCTGGGGGTGGG - Intronic
1132655656 16:1040783-1040805 CAGCTTGGGGACAGGGGCGCTGG - Intergenic
1132899249 16:2244374-2244396 CAGCGAGGCCACCTGGGAGTGGG + Intronic
1133025714 16:2988189-2988211 CAGCTGGGGGGCCTGGGCGAGGG + Intergenic
1133350719 16:5098513-5098535 GAGCGAGGGGTCCAGGGCGTGGG + Intergenic
1134061418 16:11201888-11201910 CAGAGAGGGGACCTGGCCCTGGG + Intergenic
1136068850 16:27776223-27776245 CAGGCTGGGGACCAGGGCCTGGG + Intronic
1136283892 16:29230285-29230307 CAGCGTCGCCACCTGGGAGTTGG + Intergenic
1138121195 16:54402152-54402174 AAAGGTGGGGACCTGGGGGTGGG + Intergenic
1139686202 16:68605612-68605634 GAGCGTGGGTGCCTGGGCTTAGG - Intergenic
1140427047 16:74869828-74869850 CAGTGGCGGGTCCTGGGCGTGGG - Intergenic
1142030319 16:87835301-87835323 CCCCATGGGGACCTGGGCATGGG - Intronic
1142414149 16:89932303-89932325 GGGCCTGGGGACCTGGGTGTGGG + Intronic
1142423998 16:89991077-89991099 TAGTGTGGGGCCCTGGGCATGGG + Intergenic
1142973856 17:3631326-3631348 CAGGGTGGGGACATGGGGGTGGG + Intronic
1143017371 17:3898136-3898158 CAGCGTGGGAATCCGGGGGTGGG + Intronic
1145058517 17:19718143-19718165 CATCCAGGGGACCTGGGCCTGGG + Intronic
1147176746 17:38660576-38660598 GAGAGTGGGGACCTGGGAGCAGG - Intergenic
1147262667 17:39217806-39217828 CAGCGTGGGTACTGGGGAGTGGG - Intronic
1148854093 17:50569295-50569317 CAGGGTGAGGACCTGGGCTGGGG + Exonic
1149263143 17:54900683-54900705 GAGCGTGAGGAGCTGGGCGCGGG - Exonic
1151395811 17:73822203-73822225 CAGGGTGGGGGCCTGGGAATTGG - Intergenic
1152441500 17:80312709-80312731 CAGCCTGGGGACCTGCTCATTGG + Intronic
1152548947 17:81019737-81019759 CAGCGAGGGGACTTGGGTGCAGG + Intergenic
1152590817 17:81211164-81211186 CAGCGTGGAGAACGGGGCGGCGG - Intronic
1152636051 17:81430971-81430993 CAGCGTGGGGGTCCCGGCGTGGG + Intronic
1152636066 17:81431005-81431027 CAGCGTGGGGGTCTCGGCGTGGG + Intronic
1152636079 17:81431039-81431061 CAGCGTGGGGGTCCCGGCGTGGG + Intronic
1152636092 17:81431073-81431095 CAGCGTGGGGATCCCAGCGTGGG + Intronic
1153291053 18:3501768-3501790 CAGCCTGGGGAGCTGGACATTGG + Intronic
1157617888 18:48998198-48998220 CTGAGAGGGGACGTGGGCGTGGG + Intergenic
1160575695 18:79852657-79852679 CAGCGCCTGCACCTGGGCGTGGG + Intergenic
1160635433 19:71360-71382 CAGGGGCGGGCCCTGGGCGTGGG - Intergenic
1160922625 19:1528150-1528172 CGGCGTGGGGTCCCTGGCGTGGG + Intronic
1161230381 19:3172072-3172094 CAGAGTGGGGGGCTGGGCCTAGG + Intergenic
1161479078 19:4501726-4501748 CAGCGTGGGGACCCTGGAGATGG + Intronic
1161492087 19:4567690-4567712 CAGCCTGGGGATCAGGGCGGAGG - Intergenic
1162457862 19:10796708-10796730 CAGCGTGGGGTGCAGGGGGTGGG - Intronic
1162458948 19:10803057-10803079 GAGGGTGGGGAGCTGGGTGTGGG - Intronic
1162904885 19:13817629-13817651 AAGCATGGAGACCTGGGCGCAGG - Intronic
1163502972 19:17687243-17687265 CAGAGCGTGGGCCTGGGCGTGGG + Intronic
1163658481 19:18562166-18562188 CGGCTGGGGGACCTGAGCGTGGG + Intronic
1165157518 19:33797070-33797092 CAGGGTCTGGACCTGGGCGGGGG + Intronic
1166855758 19:45782037-45782059 CAGAGTGTGGACCTGGGCCCTGG - Intronic
925055226 2:852081-852103 CAGCCTGGGGCCCTGGGCAGAGG + Intergenic
925058267 2:871903-871925 CAGCCTGGGGTCCTGGGCAGAGG + Intergenic
925169023 2:1739766-1739788 CAGCGTGGGAGCCTGGGAGGCGG - Intronic
926167846 2:10532636-10532658 CAGCCTGGGAACCTGGGGGTGGG + Intergenic
927210261 2:20634859-20634881 CAGCACGGGGACCCGGGTGTGGG + Intronic
927829406 2:26336126-26336148 CAGTGTGGGGAGCTGGAAGTAGG + Intronic
930370039 2:50490497-50490519 CAGTGTGTGGACCTGGGTCTAGG - Intronic
930760418 2:55029056-55029078 CAGGGTGGGGCCCTGGGCCAAGG + Intronic
931762747 2:65431897-65431919 CAGCGTGGGGGCCGGGGCTGAGG - Intronic
932702252 2:73999990-74000012 CAGGGTGGGGACCTGTGTTTGGG + Intronic
933727749 2:85436168-85436190 CAGCGTGGGGAGCTGTGTGATGG - Intronic
933806022 2:85998482-85998504 CAGGGTGTGGGCCTGGGGGTGGG + Intergenic
938652203 2:133395159-133395181 TAGTGAGGGGACCTGGGCTTGGG + Intronic
940716818 2:157235497-157235519 CGGGGTGGGGACCTGGGGGAGGG + Intergenic
943205338 2:184886801-184886823 CAGCGTGGGGGCCTGGGGCCTGG + Intronic
947523116 2:230863711-230863733 CAGCCTGGGGAACTGGGGGGAGG - Intergenic
948046993 2:234952319-234952341 CTGCGCGGGTGCCTGGGCGTGGG + Intronic
949059135 2:241946703-241946725 CAGTACGGGGACGTGGGCGTGGG - Intergenic
1172404342 20:34676762-34676784 GGGCGTGGGGACCGGGGCGTGGG - Intronic
1173552628 20:43943474-43943496 CAGGGTGGTCACCTGGGCGAGGG - Intronic
1173910359 20:46664348-46664370 CAGCTTTGGGGCCTGGGCATTGG + Intronic
1173939071 20:46894766-46894788 CGGCGCGGGGACCCGGGCGGGGG + Exonic
1175575297 20:60056459-60056481 CAGAGTGGGGAGCTGGGAGCAGG + Intronic
1175851882 20:62098055-62098077 CAGGGTGGGGACCTGGGCCTGGG + Intergenic
1175936645 20:62517294-62517316 CAGGGTGGGGTCCTGGGAGAAGG + Intergenic
1176229931 20:64027300-64027322 CAGCGAGGGGACCAGGGTTTGGG - Intronic
1177721614 21:24914743-24914765 GAGTGTGGGGACCTGGGGGAGGG - Intergenic
1178701476 21:34836896-34836918 AAGCGTGGGGACCTGTGCCACGG + Intronic
1182559754 22:31150420-31150442 TAGTGTGGGGACTTGGGGGTGGG - Intergenic
1182784590 22:32896952-32896974 CAGGGTGGGGACAGGGGCATAGG - Intronic
1183548604 22:38468415-38468437 CAGGGTGGGGACTCCGGCGTGGG + Intronic
1184201063 22:42970085-42970107 CAGCGTGAGGACTTGGGCTGTGG - Intronic
1184245347 22:43232967-43232989 CAGCATGGGGGCCTGGAGGTCGG - Intronic
1184935619 22:47718301-47718323 GAGCCTGGGGACCTGGGCTCAGG + Intergenic
949127494 3:463958-463980 CAGCTTGGAGACCTGAGCGGGGG + Intergenic
949942045 3:9162652-9162674 CAGCGTGGGGAGCTGGCCATGGG + Intronic
953714649 3:45306959-45306981 CAGGGTGGGGAGCCGGGGGTGGG - Intergenic
959606260 3:108244899-108244921 CAGCAAGGGGCCCTGGGCCTGGG - Intergenic
961239820 3:125400944-125400966 CAGCGTGGGGACCCTGGCATGGG - Intergenic
968523174 4:1043628-1043650 CTGCATGGGGAGCAGGGCGTTGG + Intergenic
968804706 4:2764459-2764481 CAGCGTGGGCCCCTGAGCGCTGG + Intergenic
969052075 4:4380164-4380186 CAGCGAGGGTGCCTGGGGGTTGG + Intronic
973735234 4:53865029-53865051 CAGTGTGGGGACCTCAGCGCTGG - Intronic
973735374 4:53866138-53866160 CAGCGTGGGGACCTCAGCGCTGG + Intronic
979565722 4:122152402-122152424 CAGGGTCTGGACCTGGGCGGCGG + Exonic
981172113 4:141636823-141636845 CTGGGAGGGGCCCTGGGCGTAGG - Exonic
982793766 4:159621600-159621622 CAGGGTGGGGATCTGGGGATCGG - Intergenic
989417369 5:41195437-41195459 CAGGGTGGGGTCCTGGAGGTAGG - Intronic
990760909 5:59128207-59128229 TCACGTGGGGACCTGGGCGCTGG - Intronic
991400421 5:66245634-66245656 CAGCGTGGGGGGCTGGGAGTGGG + Intergenic
991763147 5:69942916-69942938 GAGCTTGGGGACCTGGACTTGGG - Intergenic
991784180 5:70175217-70175239 GAGCTTGGGGACCTGGACTTGGG + Intergenic
991842373 5:70817952-70817974 GAGCTTGGGGACCTGGACTTGGG - Intergenic
991876627 5:71175601-71175623 GAGCTTGGGGACCTGGACTTGGG + Intergenic
995671138 5:114604168-114604190 GAGGGTGGGGACCTGGGGGAGGG + Intergenic
997980995 5:138467227-138467249 CAGCAGGGGGATCTGGGCCTGGG + Exonic
998378354 5:141706346-141706368 TAGCTTGGGGATCTGGGGGTAGG + Intergenic
998397053 5:141825459-141825481 CAGTGTGGGCACCTGGGGCTTGG + Intergenic
1000040876 5:157484434-157484456 CAGCTTGGGGGCCTGCGGGTGGG - Intronic
1002452636 5:179327645-179327667 CACCGTGGGGAAATGGGCCTGGG + Intronic
1002795473 6:467864-467886 CAGGGCGGGGACCTGAGCGAGGG - Intergenic
1003868040 6:10381377-10381399 CACGGTGGGCACCTGGGCTTTGG - Intergenic
1006950926 6:37820176-37820198 CCGGGTGGGGAGCTGGGGGTGGG + Intronic
1007104904 6:39276978-39277000 CAGAGTGAGGAGCTGGGCCTGGG - Intergenic
1007479864 6:42142672-42142694 CGGCCTGGGGAGCTGGGCGGCGG - Intergenic
1007790685 6:44306577-44306599 CAGGGTGGGGAGGTGGGGGTGGG - Intronic
1009004868 6:57772626-57772648 GAGCTTGGGGACCTGGACTTGGG + Intergenic
1011011221 6:82705767-82705789 CAGCATGGGTACCTGGGCCTGGG + Intergenic
1015244789 6:131063372-131063394 CAGGGGCGGGGCCTGGGCGTCGG - Intergenic
1019312499 7:369572-369594 CAGCCTGGGGCCCGGGGCCTCGG - Intergenic
1019339927 7:504196-504218 GAGCTTGGGGACCAGGGGGTGGG - Intronic
1019489873 7:1307334-1307356 CAGGCTGGGGACCTGGGAGTGGG - Intergenic
1019733209 7:2638554-2638576 CAGCCTGGCGACCTGGACCTCGG + Intronic
1019743696 7:2688213-2688235 CAGCGTGGGCAGCTCGGCCTGGG - Intronic
1022469858 7:30675394-30675416 CTGGCTGGGGACCTGGGCCTTGG - Intronic
1023017829 7:35984208-35984230 AAGCGTGGGGACCTGGGGCCTGG - Intergenic
1025954330 7:66170823-66170845 CAGGGTGGGGTCCTGGGGGCAGG + Intergenic
1029170515 7:98626674-98626696 CAGCGTGAGGAACTGGGGGGAGG - Intronic
1029944532 7:104517866-104517888 CAGGGTGGGGACCTGGGGGAGGG + Intronic
1031983970 7:128150413-128150435 CAGCGAGCGGACCTGGGTATAGG + Intergenic
1034536421 7:151728497-151728519 CAGCTTGGTGACCTGGGGTTGGG - Intronic
1034818653 7:154196777-154196799 CAGCCTGGGGAGCTTGGCCTCGG - Intronic
1036379445 8:8227794-8227816 GAGCGAGGGGTCCAGGGCGTGGG - Intergenic
1036785146 8:11680807-11680829 GAGCGTGGGGACCGAGGCGTCGG - Intronic
1038494601 8:27992500-27992522 CAGAGTGGGGGTCTGGGCCTGGG + Exonic
1039060081 8:33566240-33566262 CAGCGTGCGGGACTGGGCGCGGG - Intronic
1043938986 8:86175086-86175108 CAGCCTGGGTGCCTGGGCGATGG - Intergenic
1044863420 8:96545746-96545768 TAGGGTGGTGGCCTGGGCGTCGG + Intronic
1047208335 8:122820865-122820887 CTGTGTGGGCACCTGGCCGTTGG - Intronic
1047808190 8:128380444-128380466 CAGTGGGGGGACCTGGGTGTGGG + Intergenic
1049235500 8:141510417-141510439 CAGCTTGGGGACCCGGGCCTGGG - Intergenic
1049886376 9:29531-29553 CAGGGGCGGGCCCTGGGCGTGGG - Intergenic
1053000528 9:34574982-34575004 CTGCCTGGTGACCTGGGCATGGG + Intronic
1055139579 9:72860764-72860786 CAGGGTGGGGAGCTGGGAGTGGG - Intergenic
1056529936 9:87478387-87478409 CAGCTAGGGGACCTGGCCTTGGG + Intergenic
1057314798 9:93961282-93961304 CAGCCTGGGGAGCTAGGCCTGGG + Intergenic
1057828007 9:98385963-98385985 CAGAGTGAGCACCTGGGTGTTGG - Intronic
1060454895 9:123782855-123782877 GAGCGGGGGGAGCTGGGGGTTGG - Intronic
1060536365 9:124392273-124392295 CTGCGTGGGCACCTGGGAATGGG - Intronic
1060819606 9:126653817-126653839 CAGCTTGGGGGCCTGGGAGGTGG - Intronic
1060966103 9:127713133-127713155 CAGCCTGAGGTCCTGGGGGTTGG - Exonic
1061192382 9:129089282-129089304 CGGCATGGGCACCTGGGTGTGGG + Exonic
1061225566 9:129279088-129279110 CAGCGAGGTGACCTGGGTGGGGG + Intergenic
1061622622 9:131821510-131821532 CAGCTTGGGCACCTGGGAGGGGG - Intergenic
1061725303 9:132579286-132579308 CAGGGTGGGGACCTGGGGCTGGG + Intergenic
1062101122 9:134729061-134729083 CAGGGTGGGGACCGGGGCCAGGG - Intronic
1062156326 9:135050667-135050689 CAGCGTGGTGAGCTGGGCGGTGG + Intergenic
1190633537 X:52412015-52412037 CAGCCTGGGGATGTGGGTGTGGG - Intergenic
1194958168 X:100205389-100205411 CAGAGTGTGGCCCTGGGAGTAGG - Intergenic
1197898343 X:131341532-131341554 CAGCGTGGGGACCTGGGCGTGGG + Intronic
1199716368 X:150509874-150509896 CTGCGTGGGGACCTAGGACTTGG - Intronic
1200730002 Y:6724431-6724453 CAGCGTGGGGGCCTGGGGGAGGG + Intergenic