ID: 1197899307

View in Genome Browser
Species Human (GRCh38)
Location X:131352749-131352771
Sequence CATTACGACTGGAGAGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197899303_1197899307 10 Left 1197899303 X:131352716-131352738 CCATACATAAAATCATATTTTCT 0: 1
1: 0
2: 5
3: 84
4: 809
Right 1197899307 X:131352749-131352771 CATTACGACTGGAGAGAGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 96
1197899302_1197899307 14 Left 1197899302 X:131352712-131352734 CCTGCCATACATAAAATCATATT 0: 1
1: 0
2: 1
3: 11
4: 248
Right 1197899307 X:131352749-131352771 CATTACGACTGGAGAGAGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197899307 Original CRISPR CATTACGACTGGAGAGAGGT AGG Intronic
900790213 1:4675053-4675075 CATCAGGGCTGGAGAGCGGTGGG + Intronic
901014596 1:6221056-6221078 CATTACAACTGGTTAGAGGTAGG + Exonic
902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG + Intergenic
905415221 1:37799386-37799408 AATGACAACTGGAGAGAGGAAGG + Intronic
905664684 1:39755907-39755929 CATTACTACTGAAGAGAGACAGG - Intronic
906246842 1:44282301-44282323 CATTACTCCTTGAGAAAGGTGGG - Intronic
914846045 1:151283863-151283885 TCTGAAGACTGGAGAGAGGTGGG + Intronic
916500262 1:165380932-165380954 CACTACAACTGGGGAGATGTTGG - Intergenic
919786520 1:201261740-201261762 CATTGAGAGAGGAGAGAGGTAGG + Intergenic
923225983 1:231939412-231939434 CATTACAGATGGAGAAAGGTGGG - Intronic
1064719699 10:18216658-18216680 CATTGAGACTGGAGAGAGGAAGG + Intronic
1068568619 10:58604198-58604220 CAGTCCCACTGGGGAGAGGTGGG + Intronic
1070986261 10:80692732-80692754 CATTGCTAATGGGGAGAGGTGGG + Intergenic
1073988118 10:109232496-109232518 CTTTGGGACTGGAGAGTGGTAGG - Intergenic
1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG + Intronic
1076263411 10:129090243-129090265 CATTGGGACTGGAGTGAGGGTGG + Intergenic
1077785577 11:5380157-5380179 CATAATGACTGAAGAGAGGTAGG + Intronic
1078893636 11:15579271-15579293 CATTAGGATTGGAGTGGGGTTGG - Intergenic
1079982843 11:27169545-27169567 AATTCCTACTGGAGTGAGGTAGG + Intergenic
1083838873 11:65291540-65291562 CATCAGGCCTGGAGAGTGGTTGG + Intronic
1084534283 11:69747535-69747557 CATCACGAGGGGAGCGAGGTGGG - Intergenic
1088232553 11:107687726-107687748 TATTAAGATTAGAGAGAGGTTGG - Intergenic
1089657699 11:119963564-119963586 CCTTCAGAGTGGAGAGAGGTGGG + Intergenic
1091628783 12:2142294-2142316 CATTACGACGGCAGAAAGATAGG - Intronic
1094299684 12:28948740-28948762 TATTCCAACTGGAGAGAGGTGGG + Intergenic
1102425276 12:112839010-112839032 AATCATGACTGGAGAGAGGATGG - Intronic
1104584148 12:130034396-130034418 CACTGCTACAGGAGAGAGGTGGG + Intergenic
1107397884 13:40036881-40036903 CATTCCGACTGGTGTGAGATGGG + Intergenic
1109989815 13:70040037-70040059 CATTACAACTGGTGAAATGTTGG - Intronic
1120542579 14:85768393-85768415 CATCACATCTGGAGAGAGGTGGG + Intergenic
1122404421 14:101491482-101491504 CATGAAGACTGGGGAGAAGTGGG + Intergenic
1125702133 15:41696060-41696082 CAATAAGACTGGAGAGAGAGAGG - Exonic
1126938964 15:53744628-53744650 CATTACAGCTGGAAAAAGGTGGG + Intronic
1126968101 15:54078516-54078538 CATTATGACTGGTGTGAGATGGG + Intronic
1129525583 15:76211835-76211857 CATTGGGACTGGTGAGAGGGAGG - Intronic
1130422745 15:83764491-83764513 CAGGGCGACTGGAGAGAGGGAGG + Intronic
1131855596 15:96590313-96590335 GATTAGGACTGGAGTGAGGGAGG + Intergenic
1131977717 15:97961828-97961850 CATTTTGAGTGGAGAGAAGTGGG - Intronic
1137994578 16:53196317-53196339 CATTAGGGTAGGAGAGAGGTAGG - Intronic
1138540479 16:57684534-57684556 TATTGGGGCTGGAGAGAGGTGGG + Intronic
1141265122 16:82489634-82489656 CATTACAACTAGAGGCAGGTTGG - Intergenic
1141724529 16:85778470-85778492 CATCACAGCTGGAGCGAGGTGGG - Intronic
1143354249 17:6313581-6313603 CAATAAGACTAGAAAGAGGTGGG + Intergenic
1145243267 17:21251912-21251934 CATTCCCACTGGGGCGAGGTGGG + Intronic
1149395619 17:56239243-56239265 CATAAGAAATGGAGAGAGGTTGG + Intronic
1151357471 17:73568860-73568882 CATGAAGCCTGCAGAGAGGTGGG - Intronic
1162951669 19:14074795-14074817 CATTAGGCCTGGAGAAGGGTCGG + Exonic
1166791869 19:45403547-45403569 CATTACGAGTGGAGAAACGGAGG - Intronic
928680698 2:33699675-33699697 CATTGGGACTGGACAGAGGGAGG + Intergenic
929365093 2:41144732-41144754 AATTATGACTGGGCAGAGGTTGG - Intergenic
931264527 2:60648917-60648939 CATTACTGTGGGAGAGAGGTAGG - Intergenic
934118391 2:88816702-88816724 CATGGCAACAGGAGAGAGGTGGG - Intergenic
943005404 2:182383575-182383597 TATGCCGACTGGAGAGAGGTAGG + Intronic
946480593 2:220052136-220052158 CATTACAAATGGTGAGAGGAAGG - Intergenic
1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG + Intronic
1170906235 20:20517276-20517298 CATTAGGACAGGAGTGAGGCTGG + Intronic
1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG + Intergenic
1172909770 20:38399361-38399383 CGTTACTTCTGGGGAGAGGTTGG + Intergenic
1173585075 20:44176173-44176195 CATTATGACTGGTGAGAAGATGG - Intronic
1175004918 20:55671669-55671691 CATGAGGACTGGCGAGAAGTTGG + Intergenic
1175696424 20:61106202-61106224 CAGAAAGGCTGGAGAGAGGTGGG + Intergenic
1175777835 20:61664133-61664155 CATTTCCACTGGGGAGAGGCTGG - Intronic
1185018684 22:48360506-48360528 CATTGCTCCTGGAGAGAGATTGG - Intergenic
949231798 3:1758100-1758122 CATACCCACTGGAGAGAGGGAGG + Intergenic
962710317 3:138080738-138080760 CATCTTGACTGGAGAGAGGCAGG + Intronic
964486027 3:157186141-157186163 CATTAAGAGTGGACAGAGGGAGG + Intergenic
964713509 3:159696882-159696904 CATTATTAATGGAGAAAGGTAGG + Intronic
968254938 3:197261174-197261196 CATTAGGACTGGAGCTAGATAGG + Intronic
980447046 4:132922894-132922916 CAATAAGACCAGAGAGAGGTAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985752514 5:1688962-1688984 CATTGGGTCTGGAGAGTGGTCGG + Intergenic
990017643 5:51084819-51084841 CGTTTCGACTGGAGAGGGGGAGG + Intergenic
994479307 5:100313044-100313066 CATTACTACAGGAGAGATATGGG + Intergenic
996710288 5:126536625-126536647 CATCAGAACCGGAGAGAGGTGGG + Intergenic
1005585093 6:27268626-27268648 CATTCTGAATGGAGAGAGCTCGG + Intergenic
1007520039 6:42444894-42444916 GACCACGACTGGAGAGAGTTGGG - Intronic
1010578638 6:77566046-77566068 CTTTACTAATGGATAGAGGTGGG - Intergenic
1010936254 6:81865857-81865879 CATGATGAGTGGTGAGAGGTGGG - Intergenic
1011795939 6:90951349-90951371 GACTAAGAGTGGAGAGAGGTGGG - Intergenic
1015364731 6:132385002-132385024 TAGTATCACTGGAGAGAGGTGGG + Intronic
1016447620 6:144149996-144150018 GAGGCCGACTGGAGAGAGGTTGG + Intergenic
1018741028 6:166728763-166728785 CTTTACAGCTGGAGAGAGCTGGG + Intronic
1019870631 7:3757644-3757666 CCTTGCGCCTGGAGAGAGCTTGG - Intronic
1020402463 7:7794516-7794538 CATTATGACAGGAGAGATCTTGG + Intronic
1021423510 7:20472190-20472212 CATTATGAATGAAGAGAGCTGGG + Intergenic
1022225911 7:28363152-28363174 ATTTATGACTGGAGAGAGTTTGG + Intronic
1022422926 7:30241052-30241074 TATTAGGAATGGAGAGAGGTGGG + Intergenic
1023013560 7:35943946-35943968 GGTTCCGACTGGAGAGAGGGAGG + Intergenic
1023272573 7:38480530-38480552 CTTCAGGACTGGTGAGAGGTGGG + Intronic
1023335796 7:39168574-39168596 CATTACGTCAGGCCAGAGGTGGG - Intronic
1023922493 7:44640324-44640346 TATTCCCACTGGAGAGATGTGGG - Intronic
1024077568 7:45829888-45829910 GGTTCCGACTGGAGAGAGGGCGG - Intergenic
1026541699 7:71285427-71285449 CATAGCAAGTGGAGAGAGGTTGG - Intronic
1029557220 7:101278815-101278837 GATTCCCACTGGAGAGAGGGCGG + Intergenic
1036463306 8:8973477-8973499 CATTTCGCCTGGATAGAGATAGG + Intergenic
1036654897 8:10671710-10671732 CATCACGACGGGAGGAAGGTGGG + Intronic
1038349449 8:26762892-26762914 CATCAGGACTGGAGAGAGGAAGG + Intronic
1039664313 8:39506380-39506402 CTCTACTGCTGGAGAGAGGTTGG - Intergenic
1042718966 8:71806588-71806610 CATTTCTTCTGGAGAGAGTTAGG + Intergenic
1045688802 8:104739120-104739142 CATTGCCACTGGAGAGGGGGTGG + Intronic
1048114939 8:131510660-131510682 CATGAAGACAGGAAAGAGGTGGG - Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1052684622 9:31739667-31739689 CATTAAGACTGGACAGGGGTAGG - Intergenic
1188385880 X:29556929-29556951 CATTTAGTCTGGAGAAAGGTTGG + Intronic
1189147313 X:38668237-38668259 TACTATGACTGGAGAGGGGTGGG + Intronic
1197899307 X:131352749-131352771 CATTACGACTGGAGAGAGGTAGG + Intronic