ID: 1197899806

View in Genome Browser
Species Human (GRCh38)
Location X:131358494-131358516
Sequence GAAGTAAGCAGACAAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 450}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197899806_1197899808 -5 Left 1197899806 X:131358494-131358516 CCACCTTTTTGTCTGCTTACTTC 0: 1
1: 0
2: 2
3: 45
4: 450
Right 1197899808 X:131358512-131358534 ACTTCTAGCCTTGCCCTTTCTGG 0: 1
1: 1
2: 3
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197899806 Original CRISPR GAAGTAAGCAGACAAAAAGG TGG (reversed) Intronic
900681751 1:3920348-3920370 GAAGGAAGGAGAGAAAAAGAGGG - Intergenic
900681797 1:3920502-3920524 GAAGGAAGGAGAGAAAAAGAGGG - Intergenic
900856360 1:5188219-5188241 GAAGTAGGAAGAGAAAGAGGAGG + Intergenic
901989525 1:13101362-13101384 GAAGGAAACAGAAAGAAAGGTGG + Intergenic
901992288 1:13125402-13125424 GAAGGAAACAGAAAGAAAGGTGG - Intergenic
902074434 1:13771935-13771957 AATGTAAACAGACAAAAATGAGG - Intronic
904981414 1:34505946-34505968 GAAGAATGCTGACAAAAATGTGG - Intergenic
905403705 1:37719783-37719805 GAAGCAAGCAGACAGAGAAGAGG + Intronic
906414243 1:45607665-45607687 GAAGAGTGCAGAGAAAAAGGAGG + Exonic
907084065 1:51652941-51652963 TAAGGATGCAGAAAAAAAGGTGG - Intronic
908085116 1:60623706-60623728 GAATTAAGCAGTCAATAAGGGGG - Intergenic
908931944 1:69327506-69327528 TAAATAAGCTAACAAAAAGGAGG - Intergenic
910232065 1:84997357-84997379 GAAGTAAGCAGTCCCAAAAGGGG + Intergenic
910736733 1:90466688-90466710 GATGCAAACAGACAAGAAGGAGG + Intergenic
911720548 1:101186768-101186790 GAAGTAAGGAGAAAAAGAGGAGG - Intergenic
913167787 1:116204676-116204698 GAAGAAAGAAAACAGAAAGGGGG + Intergenic
913596876 1:120386860-120386882 GCAGGAGGCAGGCAAAAAGGAGG - Intergenic
913649557 1:120899274-120899296 GAAATAATGAGAGAAAAAGGAGG - Intergenic
913982533 1:143534647-143534669 GAAGGAAGGAGAAAAAAAGAAGG + Intergenic
914077127 1:144364255-144364277 GAAATAATGAGAGAAAAAGGAGG + Intergenic
914090392 1:144492121-144492143 GCAGGAGGCAGGCAAAAAGGAGG + Intergenic
914102051 1:144602250-144602272 GAAATAATGAGAGAAAAAGGAGG - Intergenic
914171579 1:145229822-145229844 GAAATAATGAGAGAAAAAGGAGG + Intergenic
914296852 1:146334948-146334970 GAAATAATGAGAGAAAAAGGAGG + Intergenic
914308215 1:146442101-146442123 GCAGGAGGCAGGCAAAAAGGAGG - Intergenic
914526688 1:148473790-148473812 GAAATAATGAGAGAAAAAGGAGG + Intergenic
914593892 1:149131032-149131054 GCAGGAGGCAGGCAAAAAGGAGG + Intergenic
914639715 1:149593333-149593355 GAAATAATGAGAGAAAAAGGAGG - Intergenic
915167948 1:153958926-153958948 GAAGTACCAAGACACAAAGGAGG + Intergenic
915292119 1:154891994-154892016 AAAGTATGCAGAAAAAGAGGGGG + Intergenic
916085942 1:161269566-161269588 GAATTAATGATACAAAAAGGAGG + Intronic
916438787 1:164801501-164801523 AAAGTAAGCAGAGAGAAGGGAGG + Intronic
916589202 1:166174124-166174146 GAAGTAAGAAGAGAAAAAAGAGG - Intergenic
916696003 1:167237070-167237092 TAAGGAAGCTGACAATAAGGAGG + Intronic
917867056 1:179206265-179206287 GGATTTAGCATACAAAAAGGTGG + Intronic
918552453 1:185758697-185758719 GAAGGAAGAAGAAAAAAAGGAGG - Intronic
918729933 1:187980529-187980551 GAGAAAAGCAGACAAAAAAGAGG - Intergenic
918892177 1:190289123-190289145 GAAGTAAGAAGGCAAAATGAAGG + Intronic
919438908 1:197601695-197601717 GAAGTACAGAGACATAAAGGGGG + Intronic
920200333 1:204256321-204256343 GAAAGAGGCAGAGAAAAAGGAGG + Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
922174744 1:223188779-223188801 GAAATAAGAAGAGAGAAAGGAGG + Intergenic
922924629 1:229337941-229337963 AAAATAAGCAAACAAAAAAGTGG + Intronic
923514140 1:234680520-234680542 GAAGGAAGGAGAAAAAAAGAAGG + Intergenic
923894531 1:238254412-238254434 GAAGTAAACAAACAAATTGGAGG - Intergenic
1064557968 10:16566549-16566571 GGAGGAAGCAGAGATAAAGGGGG + Intergenic
1064980229 10:21159211-21159233 GAAGGAATAAGAAAAAAAGGTGG - Intronic
1068561472 10:58519390-58519412 GAAGTAGGCAAAGAAGAAGGGGG + Intronic
1068973626 10:62984724-62984746 AAAGTAAGCAGACACAGAGAGGG + Intergenic
1073549218 10:104382100-104382122 GAAAGAAGAGGACAAAAAGGAGG - Intronic
1074211139 10:111336204-111336226 AAAGTCAGCAGAGAAAAAGAAGG - Intergenic
1074522058 10:114235046-114235068 GAAAGGAACAGACAAAAAGGAGG - Intergenic
1075623177 10:123942737-123942759 GAAGTAAGGAAACAAAAAGATGG - Intergenic
1076558666 10:131346840-131346862 GAAGGAAGGAGAGAAAAAGAAGG - Intergenic
1077965871 11:7132564-7132586 GAATTAACAAGACAAAGAGGGGG + Intergenic
1078291402 11:10013862-10013884 CAAGTAAGTAGAGGAAAAGGAGG - Intronic
1078343337 11:10518733-10518755 GAAATGAGGAGAAAAAAAGGAGG + Intronic
1078625224 11:12949218-12949240 GAAGCAAGCAGACAAATACCAGG + Intergenic
1079711408 11:23687470-23687492 GAAGAAAGCACCCAAAAACGCGG + Intergenic
1079918966 11:26407930-26407952 GAATTAACCAGATAAAATGGGGG - Intronic
1080673731 11:34405498-34405520 GAAGTAAGGAGATGAAACGGTGG - Intergenic
1081157537 11:39714069-39714091 GAAGTAAAGGGAAAAAAAGGAGG - Intergenic
1082674445 11:56078785-56078807 ATAGAAAGCAGAAAAAAAGGAGG - Intergenic
1083180743 11:60983076-60983098 GAAGTAAAAAAACAAAGAGGAGG - Intronic
1084545118 11:69811504-69811526 GAAGAAAGAACACAAAAAGCAGG + Intronic
1085071150 11:73547142-73547164 GGAGTAGGCAGAGGAAAAGGCGG + Intronic
1086854833 11:91853736-91853758 AAAGCAAGCAAACAAACAGGAGG - Intergenic
1087212983 11:95461962-95461984 GAACTAAGCAGAGAACAATGAGG - Intergenic
1087474116 11:98616175-98616197 GAAGCAAACAAACAAAAAAGAGG + Intergenic
1087751558 11:102012751-102012773 CAAGAAAGCAGGCTAAAAGGTGG + Intergenic
1088058538 11:105614336-105614358 GAGGTTAACAAACAAAAAGGAGG - Intronic
1088115960 11:106314386-106314408 GAAATAAGCAGAAAATAATGTGG - Intergenic
1089352960 11:117831802-117831824 GGAGTCAGGAGACAAAAGGGAGG - Intronic
1089908864 11:122075343-122075365 AAAGTAGGCAGACAATAAGAAGG + Intergenic
1092161982 12:6320255-6320277 GATGTGAGCAGATAAAAAGCAGG + Intronic
1092732368 12:11546979-11547001 GGAGAAAGCAGACACACAGGGGG + Intergenic
1092966988 12:13653577-13653599 GACTTAAACAGAAAAAAAGGAGG + Intronic
1094786622 12:33855793-33855815 TAAGTATGTAGACAAAAAGCAGG - Intergenic
1095517357 12:43021264-43021286 GAAGAAAGCAGATAAAGAGAAGG - Intergenic
1095523531 12:43097002-43097024 GAGTTAAGCAGACAAAATGGTGG - Intergenic
1096097728 12:48947861-48947883 GAAGTAATCAGACAATAAAGAGG + Intronic
1096156550 12:49344685-49344707 GAAATATGCAGACACAAAGGAGG - Intergenic
1096996653 12:55842453-55842475 GAGGTAAGCAGGTTAAAAGGGGG + Intronic
1098617338 12:72544533-72544555 GAAAAAAGGAGAAAAAAAGGGGG - Intronic
1098713412 12:73797604-73797626 TAGGTAAGTAGAGAAAAAGGTGG + Intergenic
1099223786 12:79944485-79944507 GATGTACGCAAAGAAAAAGGGGG - Intergenic
1099712001 12:86239829-86239851 GAAGAAAGGAGACATAAAAGGGG + Intronic
1100242671 12:92725445-92725467 GAATCAAGGAGATAAAAAGGAGG + Intronic
1100339936 12:93669260-93669282 GCAGTAGGCAGTCAAAAATGTGG - Intergenic
1101527735 12:105547094-105547116 GAGGTAGACAGACAAAGAGGAGG - Intergenic
1101902473 12:108800760-108800782 GAAGTAAGTGGACAGAGAGGCGG - Exonic
1102415561 12:112759600-112759622 GAAGTGAGCAGAAAACAAGGTGG - Intronic
1102836198 12:116062983-116063005 AAATAAAGTAGACAAAAAGGAGG - Intronic
1103143107 12:118568644-118568666 AAAACAAGCAGACAAAAAAGTGG - Intergenic
1103335507 12:120186442-120186464 GAAGCACGCAAACAAAAGGGAGG + Intronic
1105298317 13:19110122-19110144 GAAGCAAGAAGTCAGAAAGGAGG - Intergenic
1105497398 13:20942771-20942793 GAAGTGAGGGGACAGAAAGGAGG + Intergenic
1106219544 13:27734285-27734307 GAAGAAATCAGAAAAAAAGAGGG - Intergenic
1106622292 13:31382471-31382493 GCAGTAAGCCGAGACAAAGGAGG - Intergenic
1108778142 13:53792530-53792552 GAAGTAAGGAGACTTAAATGGGG + Intergenic
1109303532 13:60614428-60614450 CATGTAAAAAGACAAAAAGGAGG - Intergenic
1110014697 13:70386443-70386465 GAAGTATGCGGACAACAAGCAGG + Intergenic
1110021780 13:70482483-70482505 GAGGGAAGCAGACAAAAAAAAGG + Intergenic
1110777249 13:79422193-79422215 AAAGTAAGCAGTCCAAAAGAGGG + Intergenic
1112072857 13:95874110-95874132 GGAATAAGCAGACAAAAATAAGG - Intronic
1113303861 13:109054899-109054921 GAAGGAAGAAGAAAAGAAGGAGG - Intronic
1114483835 14:23051762-23051784 GCAGTATGAAGACAAAAGGGTGG + Intronic
1114896522 14:26997581-26997603 GAAGGAGGAAGACGAAAAGGAGG - Intergenic
1115504751 14:34082818-34082840 GAAGAAAGCAGCTAAAATGGAGG - Intronic
1116291054 14:43041129-43041151 GACATAAGCAGAGAATAAGGAGG + Intergenic
1116419082 14:44712579-44712601 GAAGTCAGAAAAGAAAAAGGAGG - Intergenic
1116832448 14:49734983-49735005 TTAATAAGCAGACAAAAATGGGG + Intronic
1117164996 14:53024369-53024391 GGAGTAAGGAGACATAATGGGGG - Intergenic
1117436620 14:55721031-55721053 GAAGTCAGGAGACACAAAGTTGG + Intergenic
1119428154 14:74549461-74549483 GAGGTAAGGAGATAAAGAGGAGG + Intronic
1120057283 14:79939320-79939342 AATGTAAACAGACAAAAAGAAGG - Intergenic
1120267481 14:82269683-82269705 GAAGTCACCAGTCAAAAAGTGGG + Intergenic
1120389322 14:83885595-83885617 GAAGAAAGAAGCCAAAAAGTTGG - Intergenic
1121314245 14:92951767-92951789 GAAGCAAGCAGAGGAACAGGGGG + Intronic
1121422878 14:93827903-93827925 GAAGTTTCCAGAAAAAAAGGGGG + Intergenic
1122135007 14:99627753-99627775 GAAGTCACCAGGCAAAAAGGGGG + Intergenic
1124091932 15:26613453-26613475 GAAGGAAGGAAACAAAAATGTGG + Intronic
1124795644 15:32775519-32775541 GAAGGAAGAAGACAAAAATCAGG + Intronic
1125101425 15:35917431-35917453 GAAATAACCAAACAAAAAGATGG + Intergenic
1126388516 15:48119931-48119953 GAAGGAAGGAGAGAAAGAGGAGG + Intergenic
1126658240 15:51004375-51004397 GAAGTAAGGACACAAAAAATTGG - Exonic
1127548901 15:60017496-60017518 GAAGGAAGAAGAGAAAGAGGAGG + Intronic
1127764979 15:62176601-62176623 CAAGTAAGCATACAAAATGCAGG + Intergenic
1128236366 15:66070290-66070312 GAAGTGAGCAGCCAGAGAGGTGG + Intronic
1128478519 15:68017721-68017743 GAAGGAAAAAGAAAAAAAGGAGG + Intergenic
1129520878 15:76185638-76185660 CAAGTAAGCAGAAAAACATGTGG - Intronic
1129959725 15:79673187-79673209 AATGTAACCATACAAAAAGGAGG - Intergenic
1130434634 15:83885708-83885730 GAACTAAGCAGACAATAAGCAGG - Intronic
1130733408 15:86522961-86522983 GAAGGAAGCAGCCAGGAAGGTGG - Intronic
1131570498 15:93530306-93530328 GAAGAAAGCAGAGAAAACAGTGG + Intergenic
1131728910 15:95258120-95258142 GAAAAAAGCAGGCAAAAATGTGG - Intergenic
1131756828 15:95573451-95573473 TTAGTAAGCTGAGAAAAAGGAGG + Intergenic
1132716968 16:1295694-1295716 GAAGTCTGCAGAAAAAAATGGGG - Intergenic
1133717925 16:8467045-8467067 GAAGGAAGAAGAAAGAAAGGAGG + Intergenic
1134137400 16:11687091-11687113 AGGGAAAGCAGACAAAAAGGGGG - Intronic
1135358832 16:21793642-21793664 AAAGCAAGCAAACAAAAAGGAGG - Intergenic
1135457388 16:22610078-22610100 AAAGCAAGCAAACAAAAAGGAGG - Intergenic
1136087683 16:27897292-27897314 AAAGGAAGAAGAAAAAAAGGAGG - Intronic
1136726094 16:32358923-32358945 GAAGTAAGCATCCAGAGAGGTGG - Intergenic
1136844428 16:33564968-33564990 GAAGTAAGCATCCAGAGAGGTGG - Intergenic
1137831009 16:51543413-51543435 GAAATGCGCAGACACAAAGGGGG + Intergenic
1138612980 16:58142119-58142141 GGAATAAGCAGACAAGATGGAGG - Intergenic
1139184601 16:64791091-64791113 GTAGAAAGAAGACATAAAGGAGG + Intergenic
1139303186 16:65962354-65962376 TAAGAAAGAAGACAAAAAGTTGG + Intergenic
1139304939 16:65977171-65977193 ATAGTAAGAAGACAAAATGGTGG + Intergenic
1141158015 16:81610416-81610438 GGAGGAAGCAGAGGAAAAGGAGG + Intronic
1141395412 16:83700187-83700209 GAAGGAGCCAGACAAAAAAGAGG - Intronic
1142241236 16:88947277-88947299 AAATTCAGCAGACAAAAATGAGG + Intronic
1203000337 16_KI270728v1_random:158833-158855 GAAGTAAGCATCCAGAGAGGTGG + Intergenic
1203131939 16_KI270728v1_random:1695236-1695258 GAAGTAAGCATCCAGAGAGGTGG + Intergenic
1203154595 16_KI270728v1_random:1865267-1865289 GAAGTAAGCATCCAGAGAGGTGG - Intergenic
1143180136 17:4979631-4979653 GGAGTCAGAAGACAAATAGGAGG + Intronic
1144363430 17:14518923-14518945 AAAGTAAGCAAAGAAAAAGGAGG - Intergenic
1145319934 17:21759837-21759859 GAAGCCAACAGACAAAAAAGAGG + Intergenic
1146626303 17:34438063-34438085 GAACCAAGCAGACAAGAAGAGGG + Intergenic
1146911647 17:36652118-36652140 GAAGGAAGAAGAGAAAAAAGAGG - Intergenic
1147355471 17:39892627-39892649 GAACTAAGCAGGGAAAAAAGGGG - Intergenic
1149100148 17:52896122-52896144 AGAGTAAACAGACAAAAGGGTGG + Intronic
1149306538 17:55352497-55352519 GAAGAAACAAGAGAAAAAGGGGG + Intergenic
1149362433 17:55910133-55910155 GAAGTATGCAGACAAGTAGAGGG + Intergenic
1149657351 17:58317271-58317293 GAAGCAAGGAGGCAGAAAGGAGG + Intronic
1149672736 17:58429921-58429943 GAAATGACCAGACAAAAAGAAGG + Intronic
1150940623 17:69689407-69689429 GTAGTAAACAAACACAAAGGGGG + Intergenic
1151928164 17:77213811-77213833 GAAGTGAGCAGAGAACAGGGTGG + Intronic
1152425438 17:80216026-80216048 GAAGTAAGGACACAAAAGGGGGG + Intronic
1153846378 18:9053209-9053231 TAACTCAGCAGAGAAAAAGGGGG - Intergenic
1154300551 18:13187563-13187585 GAAGTAAGCTGAAAAAAATTAGG - Intergenic
1156722600 18:40088479-40088501 GAAATGAGCAGACATAAAGATGG - Intergenic
1156937609 18:42729796-42729818 GAAGAAAACACACAAAATGGAGG + Intergenic
1156946262 18:42836478-42836500 GAAAACAGCAGAAAAAAAGGAGG + Intronic
1158127535 18:54118423-54118445 GAAACAGGCAGAAAAAAAGGGGG + Intergenic
1158339903 18:56454765-56454787 GAAGGAAGGAGAAAAAAGGGAGG + Intergenic
1159564396 18:70032227-70032249 GAAGCCAGCAGACCAAAGGGTGG - Intronic
1160135265 18:76266214-76266236 GAAGAAAGAAAAGAAAAAGGAGG + Intergenic
1160228853 18:77031454-77031476 GAAGAAAGCTAAGAAAAAGGAGG + Intronic
1162215063 19:9127360-9127382 GAAGGAAGGAGAAAAAGAGGAGG - Intergenic
1162851832 19:13437038-13437060 GAATTAAGCAGATACAGAGGAGG + Intronic
1163994605 19:21031624-21031646 GATGGTAGCAGACAAAAAGGTGG + Intronic
1164201926 19:23026185-23026207 GAAGTAAAGAAACAAAAAGATGG - Intergenic
1164234863 19:23323163-23323185 GAAGGAGGAAGAGAAAAAGGTGG - Intronic
1164250095 19:23468481-23468503 GAAGAAGGGAGAGAAAAAGGTGG - Intergenic
1164654439 19:29910312-29910334 GAAGGAAGGAGAGAGAAAGGGGG - Intergenic
1164794388 19:31014538-31014560 GAAGAAAGAAGAGAAAAAAGAGG + Intergenic
1166889350 19:45981000-45981022 GAAGTAAGGAGCCCAATAGGAGG + Intergenic
1168145779 19:54419394-54419416 GGAGGAAGCAGACAGGAAGGAGG + Intronic
925605568 2:5656230-5656252 GCAGGAGGCAGGCAAAAAGGAGG - Intergenic
926292911 2:11544742-11544764 GAGGTGAGCAGGCAAACAGGGGG - Intronic
926347098 2:11957246-11957268 GAAGTATGAAGAAAAAAAGTAGG - Intergenic
927318738 2:21718047-21718069 GAAGTGAGAAGACAAAATTGTGG + Intergenic
928342576 2:30457728-30457750 GAAAGAAACAAACAAAAAGGTGG - Intronic
928510188 2:31995599-31995621 AAAGGAAACAGAAAAAAAGGGGG + Intronic
928643935 2:33331740-33331762 ATAGTAAGCAGACAAAAAATCGG - Intronic
928932149 2:36635990-36636012 GAAGTAAACAGACAAATAGAAGG + Intronic
930395852 2:50823768-50823790 TAAGTAAGCACACAAAATGAAGG + Intronic
931206516 2:60150809-60150831 GAGGGAAGAAGAGAAAAAGGAGG - Intergenic
931440563 2:62287428-62287450 GAAGGAAGCAGCCAAAGTGGAGG - Intergenic
931794960 2:65700349-65700371 GAAATAAGCAGGCAGAAAGTTGG + Intergenic
931851791 2:66258732-66258754 GAATTTACCAGACAAAAAAGAGG - Intergenic
932207645 2:69897675-69897697 GAAGTGATCAGACAAAGAAGAGG + Intronic
932640274 2:73439016-73439038 GAAAAAAGAAGAAAAAAAGGAGG - Intronic
932735731 2:74252935-74252957 GCAGTAGGGAGAGAAAAAGGAGG - Intronic
933859825 2:86454765-86454787 AAAGTAAGCAAACAAACAGCTGG - Intronic
934319792 2:91961658-91961680 GAAGTAAGCATCCAGAGAGGTGG + Intergenic
935316237 2:101837038-101837060 GAAAGAAGAACACAAAAAGGAGG - Intronic
935519031 2:104081165-104081187 GAAGTTATCAGAGATAAAGGGGG - Intergenic
936342243 2:111643885-111643907 GAAGGCAGCAGACAAAAAGATGG + Intergenic
936756034 2:115713739-115713761 GGAGGAGGAAGACAAAAAGGAGG - Intronic
936813595 2:116432873-116432895 GATGAAAGCAGCCAGAAAGGAGG - Intergenic
937105428 2:119307760-119307782 AAAGTAAGAGGACAAAAAGAGGG + Intronic
937673207 2:124560790-124560812 GCAGCAAGCAGCAAAAAAGGGGG - Intronic
937879343 2:126853364-126853386 GAAGTATGCAGACTAAGAGATGG + Intergenic
938126824 2:128680307-128680329 GAAGAAAGGAGGGAAAAAGGAGG - Intergenic
938519145 2:132048804-132048826 GAAGTAAGGAAGGAAAAAGGAGG - Intergenic
938869898 2:135464271-135464293 GAAGAAAGAAGAACAAAAGGAGG - Intronic
939220625 2:139297302-139297324 GAAGTAGTCAGAGAAAAATGTGG - Intergenic
939589321 2:144044001-144044023 GATCTAAGTAGCCAAAAAGGAGG - Intronic
939622885 2:144441712-144441734 GAAGCTAACAGAGAAAAAGGTGG - Intronic
940434389 2:153633550-153633572 GTAGTAGGCAAACAAAGAGGAGG - Intergenic
940968959 2:159873157-159873179 GAAGAAAGAAGAAAAAGAGGAGG + Intronic
941102128 2:161308222-161308244 GAGGTAGGGAGAGAAAAAGGAGG + Exonic
942262024 2:174175467-174175489 GAAGTAAGCAAATGAAAAGATGG + Intronic
943018005 2:182537798-182537820 GAAGTAATCAGAAGAAAAGTGGG + Intergenic
943214230 2:185009969-185009991 GAAGGAAAGAGAAAAAAAGGAGG - Intergenic
943579833 2:189672294-189672316 GGAGTAAATAGACAAAAAGGTGG - Intergenic
943890310 2:193277548-193277570 GAAGGTGGCAGACAAAGAGGTGG - Intergenic
944201060 2:197107852-197107874 GAAGGAAGCCAACAAACAGGAGG + Intronic
944856473 2:203772740-203772762 CAAGTAAGTATAGAAAAAGGTGG - Intergenic
945747592 2:213737457-213737479 AAAGTAAGGAGAAAAAAAGTTGG - Intronic
946770893 2:223087146-223087168 GCAGTAAGTAGAAAGAAAGGAGG - Intronic
947023330 2:225708711-225708733 GAAGTCATCAGAAAATAAGGTGG - Intergenic
948691213 2:239706306-239706328 GAAGAAAACAGAGAGAAAGGGGG - Intergenic
1169730474 20:8780343-8780365 GAAGAAAGAAGACAAAATGGTGG - Intronic
1170020731 20:11834087-11834109 GGAGGAAGGAGACAGAAAGGAGG + Intergenic
1170391725 20:15882139-15882161 AAAGTAAGCTGACAAAAGGCAGG + Intronic
1170918847 20:20656264-20656286 TAAGTAAGCATACAAATAGCTGG - Intronic
1171028232 20:21652305-21652327 CAAGTAAACAGACAAAAATCAGG - Intergenic
1171246219 20:23611770-23611792 GGGGTAGGCAGGCAAAAAGGAGG + Intergenic
1171997818 20:31746194-31746216 GAAGTTAGCAAACATAAATGTGG + Intronic
1172554867 20:35832072-35832094 GAGGAAAGCAGGCAAAAAAGAGG - Intronic
1173959034 20:47057116-47057138 GAAGGAAGAAGACAGGAAGGAGG + Intronic
1175056671 20:56205038-56205060 GAAATAAGAAGAAAAATAGGAGG + Intergenic
1175064423 20:56272960-56272982 GAAGTATGCAGACAAGCAGAGGG - Intergenic
1175282735 20:57814898-57814920 AAAGGCAGCAGCCAAAAAGGAGG + Intergenic
1176249279 20:64112553-64112575 GAAGCACGCAGACAGGAAGGAGG + Intergenic
1176960035 21:15149020-15149042 TGAGTAAGCATTCAAAAAGGAGG + Intergenic
1177257295 21:18682114-18682136 CAAACAAGCAGACAAAAACGGGG + Intergenic
1178187416 21:30239256-30239278 AATGTATACAGACAAAAAGGAGG + Intergenic
1178231386 21:30788799-30788821 CAGGTAAGCAGACAAAATGGAGG - Intergenic
1178878875 21:36433015-36433037 AGAGTAAGCAGACAAAAAGCAGG - Intergenic
1179466399 21:41577604-41577626 CAAGTAAGCAGAGTAAAAGGAGG - Intergenic
1179475080 21:41637875-41637897 GAAGTAAGGAGAAACAAAAGAGG - Intergenic
1179945794 21:44674272-44674294 GAAGTAACAAAACAAAAAGTTGG + Intronic
1180862425 22:19092983-19093005 GAAGAAAGAAGAGAAGAAGGAGG + Intronic
1181987240 22:26808720-26808742 GGAGTAGGCAGGCCAAAAGGAGG - Intergenic
1182189059 22:28440404-28440426 CAAGTAAGCAGAGAAAAGAGAGG + Intronic
1182634463 22:31713431-31713453 GAAGTTAGAAGACCAGAAGGAGG - Exonic
1182737495 22:32541450-32541472 GCAGTAAGGAGACAGGAAGGAGG + Intronic
1182960470 22:34467478-34467500 GAAATATGCAGAGAAAAACGTGG + Intergenic
1184999420 22:48235327-48235349 GAAGGAAGAGGAGAAAAAGGAGG - Intergenic
1185235498 22:49710421-49710443 GAAGAAAGGAGACAAGGAGGAGG + Intergenic
949498060 3:4652341-4652363 GAAGGAAACAGAAAAACAGGAGG - Intronic
949734268 3:7153177-7153199 AAAATAAGCAGAAACAAAGGAGG - Intronic
949935628 3:9113485-9113507 GAAGTAATCAGATAAAAATGAGG - Intronic
949967189 3:9367355-9367377 GAAGAAAGCAGAGCAAAAGCAGG - Intronic
950907264 3:16550685-16550707 GAAGTAAGCAAGCAATAAGAAGG - Intergenic
951046517 3:18045645-18045667 GAATTAAGGAGACAAAAACAGGG - Intronic
951110648 3:18799746-18799768 GAGGGAAGGAGAGAAAAAGGAGG - Intergenic
951412345 3:22380240-22380262 GAAGTAAGAAAAGAAAAAGGAGG + Intergenic
951552575 3:23889219-23889241 GAAGTGAGCAGATAGAAAGGAGG - Exonic
951610807 3:24491107-24491129 CAAGTTAACAGAAAAAAAGGGGG - Intronic
951637761 3:24798499-24798521 GAGATAAGCTGACAAAAGGGTGG + Intergenic
951661186 3:25068445-25068467 AAACTAAGAAAACAAAAAGGGGG + Intergenic
954382337 3:50226396-50226418 GAAGAAAGCCGACAGAAGGGCGG + Intronic
955283453 3:57616335-57616357 GAAGGAAGAAGAAGAAAAGGAGG + Intergenic
955463403 3:59210392-59210414 GATGTAATCAGAGAAGAAGGAGG - Intergenic
956619284 3:71204672-71204694 TAAGGAAGCAGACAGAAAGATGG + Intronic
958543520 3:95510555-95510577 GAAATAAGCCAACAGAAAGGGGG - Intergenic
958557353 3:95697182-95697204 GAATTAACCAGACAAAATGCTGG + Intergenic
960022051 3:112965885-112965907 GAAGGAATGAGACAAAAAGCAGG + Intronic
960123259 3:113969037-113969059 GAGGAAAGCAAAGAAAAAGGGGG + Intronic
960375142 3:116891668-116891690 TAAGTAGGCAGACAAGAAGCTGG + Intronic
961057180 3:123799105-123799127 GAAGTAAGAAGAAAAAACAGGGG + Intronic
961340111 3:126212242-126212264 GAAGGAAGGAGAGAAGAAGGAGG + Intergenic
962122415 3:132575931-132575953 GAAGAAAGGGGAAAAAAAGGGGG + Intronic
962469409 3:135692389-135692411 GAAGTAAACATAGAAAAAAGGGG - Intergenic
962596890 3:136955334-136955356 AAAGTAAACAGAGAAAATGGAGG - Intronic
962968286 3:140374295-140374317 GAAGGAAGAAGAAAAAAAGGAGG - Intronic
963324442 3:143846476-143846498 GAAATAGCCAAACAAAAAGGAGG - Intronic
963602209 3:147388436-147388458 GCAGAAAGCAGAAACAAAGGGGG + Exonic
963797802 3:149648602-149648624 GAGTTAAGCAGGCAAAAAGCAGG + Intronic
964753041 3:160069496-160069518 GATGTGAGCAGACAAAAACCTGG - Intergenic
965273438 3:166649310-166649332 GAAGTAAGCAAAGAAAAATGAGG - Intergenic
965292349 3:166899622-166899644 GAAGTAAGTAAAATAAAAGGAGG - Intergenic
965509060 3:169548279-169548301 TAAGTAAATAGAGAAAAAGGTGG - Intronic
966392268 3:179465230-179465252 GAAGGAGTCAGACAAAAAGCCGG + Intergenic
966457257 3:180131675-180131697 GAAGAAAGCAGAGAGAAAAGTGG + Intergenic
967180256 3:186897105-186897127 GAATTAAGGAGACAAAAAAAGGG - Intergenic
969541640 4:7794442-7794464 AAATTAAGCAGACCAAATGGAGG - Intronic
969920866 4:10538445-10538467 GAAGTAAGAAGACAGAAAATAGG - Intronic
969993294 4:11286614-11286636 GAAGTTAGAAGACAGAAACGTGG - Intergenic
972129266 4:35809447-35809469 GAACTAAACAGAAAAAAAGAAGG + Intergenic
972403545 4:38726477-38726499 GAAGAAAGCAGTTAATAAGGTGG - Intergenic
973589599 4:52427447-52427469 CAAGATAGCAGACCAAAAGGTGG - Intergenic
973712105 4:53640418-53640440 AAAGTAAACAGAAAAAAATGGGG + Intronic
974098975 4:57396127-57396149 GAGGTAAGCAGTCAAAAGGAGGG + Intergenic
975151474 4:71027087-71027109 GGACAAAGCAGAGAAAAAGGGGG - Intronic
975455777 4:74588157-74588179 GAGGTAAGCAGGTAAAAAGTAGG + Intergenic
975588628 4:75977942-75977964 CAAGTAAGCATATAAAAAGGAGG + Intronic
976069829 4:81228556-81228578 CAATAAAGCAGAGAAAAAGGTGG + Intergenic
976864493 4:89707591-89707613 GAAGTACTGAGACAGAAAGGAGG - Intergenic
976945349 4:90759016-90759038 CCAGTAAGAAGACAAAAGGGAGG - Intronic
977419014 4:96773924-96773946 GAAGTTAGCTGAGAAAAATGTGG + Intergenic
978901403 4:113954212-113954234 GGAGGAAGAAGACAAACAGGAGG - Intronic
979233724 4:118375689-118375711 GAAGGAAGAAGAAAAAAAGGAGG - Intergenic
980407384 4:132370650-132370672 GAAGAAAACACACAAAAATGTGG - Intergenic
981102863 4:140849663-140849685 GAAACAAGCAAACAAAAAAGAGG + Intergenic
981301303 4:143189029-143189051 AAAAAAAGCAGACAAAAAGAGGG + Intronic
981512113 4:145568732-145568754 CAAGTAAACAGAAAAAAAGTGGG + Intergenic
981700868 4:147605897-147605919 GCAGTAATGGGACAAAAAGGAGG - Intergenic
982146546 4:152400924-152400946 GAAGTAAGCACAGGAAAAGATGG + Intronic
982359954 4:154508890-154508912 GAAATAAGCAAACAAGAAGGAGG + Intergenic
982686686 4:158498467-158498489 GAAGAATGCAGAAAAAAAGGAGG + Intronic
983387037 4:167077866-167077888 GAAGGAAGAAAAGAAAAAGGAGG + Intronic
983454188 4:167941680-167941702 GAAGAAAGCAGACTATTAGGTGG - Intergenic
983750725 4:171266095-171266117 GAAAGAAGAAGAAAAAAAGGAGG - Intergenic
983775928 4:171607844-171607866 GAAATAAGAAGAAAAAAAGGGGG - Intergenic
983921806 4:173354201-173354223 GAAATAAGACAACAAAAAGGAGG + Intergenic
984019253 4:174465178-174465200 GAACTAAGCAATGAAAAAGGAGG - Intergenic
984282974 4:177694463-177694485 GAATTAACCAGTCCAAAAGGTGG - Intergenic
986401286 5:7384219-7384241 GTAGTAAGAAGAAAGAAAGGAGG + Intergenic
986746973 5:10753520-10753542 GAGGTAAGCAAACACCAAGGAGG + Intronic
987179085 5:15347656-15347678 GAGGTAAGCAAACAAAAGTGAGG + Intergenic
988256642 5:28829335-28829357 GAAGAAAAAAGAAAAAAAGGAGG - Intergenic
988330643 5:29835112-29835134 AAAGTCAGCAGAAAAAAAGTAGG + Intergenic
988602873 5:32655846-32655868 GGAGTAAGCAGACAGAAAAAAGG + Intergenic
988670903 5:33380180-33380202 TAAGTAAGCAAACCAAAAGTGGG - Intergenic
989227759 5:39049932-39049954 GAGGTAACAAGACAAAATGGGGG + Intronic
989420526 5:41234998-41235020 CAAGTTAGCAGCCAAAAATGAGG + Intronic
989439250 5:41450898-41450920 AATGGAAGCAGAAAAAAAGGAGG + Intronic
989689318 5:44121348-44121370 GAAGTAAGCTGAAAAAACAGAGG + Intergenic
989726542 5:44594095-44594117 GAAACAAGCAGAAAAAAACGGGG - Intergenic
990958684 5:61369620-61369642 CAAGTAAGCAGACATAAATAGGG - Intronic
991282296 5:64929085-64929107 GAAGAAAGGAGATAAAAATGTGG + Intronic
991530643 5:67610135-67610157 GAAGCAAGGAGAAAAAAAGAGGG - Intergenic
993041251 5:82817289-82817311 GGAGTAAGCAGAGAAACAGAGGG - Intergenic
993548012 5:89237118-89237140 GAAAGAAGAAGACGAAAAGGAGG - Intergenic
994355116 5:98785992-98786014 AAAGGAAGCAGAGAAAAATGGGG + Intronic
994797805 5:104328855-104328877 GAAGGAAGAAGACAAAAACTGGG + Intergenic
994818398 5:104615023-104615045 GAAGTGACCAGAATAAAAGGAGG - Intergenic
994898425 5:105737323-105737345 GAAGAAAACATACAAAAAGATGG + Intergenic
995241769 5:109893071-109893093 TGAGTAAGCTGAGAAAAAGGAGG + Intergenic
995439983 5:112180932-112180954 CCAGTAAGCACACAAAAATGTGG + Intronic
995980236 5:118093120-118093142 GAAGGAAACAGAGAAAAAGAAGG + Intergenic
997844251 5:137272008-137272030 GAAGGAAGCAAATTAAAAGGAGG + Intronic
997960498 5:138316912-138316934 GAGGTAAGCAGACAAGTAGAGGG - Intronic
998459072 5:142296036-142296058 GAAGGAGGCAGACAAGAAGCAGG - Intergenic
998566377 5:143219622-143219644 GAAGACAGCAGAAAGAAAGGGGG + Intronic
998990859 5:147814637-147814659 GAAGTAAGAAAAGAAAAATGAGG - Intergenic
999011310 5:148043844-148043866 GAAACAAGAAGACAAAAAGAAGG - Intronic
1000288848 5:159850931-159850953 GAAGAGAGCAGACACACAGGAGG + Intergenic
1000360293 5:160440872-160440894 GCTGTAGGCACACAAAAAGGAGG - Intergenic
1001864652 5:175092976-175092998 GCAGTGAGCAGACAAATAGCAGG - Intergenic
1002012828 5:176297643-176297665 TAGGTGAGCAGACAAAAAGTTGG - Intronic
1002215013 5:177625092-177625114 TAGGTGAGCAGACAAAAAGTTGG + Intergenic
1002329605 5:178432564-178432586 GAAAGAAGCAGAGAACAAGGAGG + Intronic
1003467492 6:6394785-6394807 GGAGAAAGCAGATAAAGAGGAGG + Intergenic
1004129001 6:12901398-12901420 GAAGAAAGCAGAGAGAAAGGAGG + Intronic
1004582710 6:16969983-16970005 GAAGGAAGGAGAAAGAAAGGAGG + Intergenic
1005115015 6:22326590-22326612 TAATTAAACAGACAAAAAGATGG - Intergenic
1005269410 6:24147351-24147373 GAAGGAAGAAAAAAAAAAGGGGG - Exonic
1005658183 6:27965445-27965467 GAAGAAAGATGACAAGAAGGAGG + Intergenic
1005823860 6:29620367-29620389 GTAATAAGCAGACACATAGGTGG + Intronic
1005925862 6:30444939-30444961 GAAGTGAGGACACAAAAATGTGG + Intergenic
1006909714 6:37556003-37556025 GATGGAGACAGACAAAAAGGAGG - Intergenic
1007870419 6:45030342-45030364 GAAGTAAGCTGAGAAAGAAGAGG - Intronic
1008438325 6:51502259-51502281 GCATGAAGCAAACAAAAAGGTGG - Intergenic
1008709882 6:54211926-54211948 GAACTAAGAACACAAAAAGAAGG - Intronic
1008880072 6:56372744-56372766 GAATTAAGCCAACATAAAGGAGG - Intronic
1009029858 6:58043653-58043675 GAAGGAAGCATACAAAAAATTGG - Intergenic
1009205385 6:60794891-60794913 GAAGGAAGCATACAAAAAAGTGG - Intergenic
1009747807 6:67841573-67841595 AAAGAAAGAAGAAAAAAAGGAGG - Intergenic
1009751621 6:67884201-67884223 GAAGTAGGGAGACAAAACCGGGG + Intergenic
1009901590 6:69813540-69813562 GAGGTAGTCAGAAAAAAAGGAGG + Intergenic
1010432459 6:75794024-75794046 GAAGTAATCAGAGACAATGGAGG + Intronic
1010516983 6:76785318-76785340 GAAGAAAGAAGAGAAAAAAGGGG - Intergenic
1010683687 6:78826146-78826168 AATGTAAGCAAACAAAAGGGAGG + Intergenic
1010964734 6:82191811-82191833 GAAGAAAGTAGACAAAAATGTGG - Exonic
1011795610 6:90948311-90948333 GAAGTATGCAGACAAGTAGGGGG - Intergenic
1011972762 6:93248155-93248177 AAAGTAGGCAAACAAAAAGCTGG + Intronic
1012051490 6:94350752-94350774 GAACTAGAAAGACAAAAAGGAGG - Intergenic
1013337208 6:109175999-109176021 GAAATAAGCAAACAAAAACAGGG - Intergenic
1014396993 6:120936205-120936227 AAAGGAAGGAGAGAAAAAGGAGG + Intergenic
1014695722 6:124618835-124618857 GAAGGAGGCAGACATAAAAGAGG + Intronic
1014948654 6:127528168-127528190 GAGGAAAGCAGACATACAGGGGG - Intronic
1016223855 6:141709351-141709373 GAAGTAAGAAAAGAAAAAGTTGG + Intergenic
1016344690 6:143100426-143100448 AAAGAAAGCAGAAAAAAAGAAGG + Intronic
1016472605 6:144390286-144390308 GAAGTAATGAGACAAGAAAGGGG - Intronic
1016599741 6:145844501-145844523 TAAGCAAACAGACAGAAAGGAGG - Intergenic
1017262469 6:152402939-152402961 GAAGTAAGAAGACACAAAGGAGG - Intronic
1017726244 6:157278031-157278053 GAAGGAGGGAGTCAAAAAGGTGG + Intergenic
1018275213 6:162123065-162123087 GAAGTAACAAGAAAAAACGGGGG + Intronic
1018406243 6:163485632-163485654 GAAGGAAGGACAGAAAAAGGAGG - Intronic
1018937160 6:168281065-168281087 GAAGTGAGCACACACAGAGGGGG - Intergenic
1019208319 6:170382035-170382057 AAAGCATGCAGACAAAAAGAAGG + Intronic
1019931914 7:4229332-4229354 GAAGTAAGCAGAATAAAAATGGG + Intronic
1020187030 7:5967080-5967102 GAAAAAAGCAGACAAAAAAGGGG - Exonic
1020295887 7:6757692-6757714 GAAAAAAGCAGACAAAAAAGGGG + Exonic
1020686706 7:11305130-11305152 GAAACAAGCAGACAAAAATTAGG + Intergenic
1021299072 7:18949007-18949029 CAAGCAAGTACACAAAAAGGTGG - Intronic
1023105649 7:36760917-36760939 GAAGTAAGCAGCCACACTGGGGG + Intergenic
1023887682 7:44372574-44372596 GAAGGAGGAAGACAAAGAGGAGG + Intergenic
1025078549 7:55963789-55963811 GAAGGAAGGAGAAAGAAAGGAGG - Intronic
1026112100 7:67466448-67466470 GAAGGAAGGAGAGAAGAAGGAGG - Intergenic
1027217651 7:76194289-76194311 GGAGTGAGGAGAGAAAAAGGAGG + Intergenic
1027402749 7:77825171-77825193 GAAAGAAGCAGACAAAAAAGGGG + Intronic
1027786751 7:82589928-82589950 GAAGGAGTCAGACAAAAAGCTGG - Intergenic
1027865521 7:83640978-83641000 GAAGGAAGTAGAGAAAAAGGTGG + Intronic
1027936895 7:84617228-84617250 GAAGTAAAGAGACAAAAAGGTGG - Intergenic
1027936955 7:84618391-84618413 GAAGGAAAGAGACATAAAGGTGG - Intergenic
1028274982 7:88844429-88844451 GAAGGAATTAGACAAATAGGTGG - Intronic
1028405707 7:90471541-90471563 AAAGTAACCAGACAACAAAGGGG + Intronic
1028458650 7:91066338-91066360 GGAGTGAGCAGACAAAGAGGGGG - Intronic
1029200619 7:98836887-98836909 GAAATAAGCAGAAAATAAGCTGG - Intergenic
1029368400 7:100131374-100131396 GAAGGAAGGAGAGAAAAAGAAGG - Intergenic
1030118072 7:106078802-106078824 GAAGGAAGGAAAAAAAAAGGAGG - Intergenic
1031668415 7:124514156-124514178 GAAGCATGCAGAAAACAAGGGGG + Intergenic
1033874311 7:145795380-145795402 GAAGGAAGGAGAAAAAGAGGGGG + Intergenic
1034080678 7:148275253-148275275 GAAGTAAAAAGACAAGAGGGTGG + Intronic
1034465516 7:151226416-151226438 GAAGAAGGCAGCCAAAAAGAAGG - Exonic
1036054931 8:5240961-5240983 CAAGCAAACAGAAAAAAAGGAGG + Intergenic
1036296855 8:7544322-7544344 AAAGAAAGAAGAAAAAAAGGTGG + Intergenic
1036325712 8:7776697-7776719 AAAGAAAGAAGAAAAAAAGGTGG - Intergenic
1037423449 8:18728468-18728490 GAGTTACCCAGACAAAAAGGAGG + Intronic
1037606912 8:20445831-20445853 CAAATAAGCAGAAATAAAGGTGG + Intergenic
1038349476 8:26763079-26763101 GGAGGAAGAAGAGAAAAAGGAGG + Intronic
1038997036 8:32935108-32935130 TAAGTAAGCCCACAAAAAGTGGG + Intergenic
1039121191 8:34148566-34148588 GAATTATGCAAACAAAAAGTAGG + Intergenic
1039611496 8:38922914-38922936 GAGGGAGGCAGACAAAGAGGAGG - Intronic
1039824909 8:41164738-41164760 GAAGGAAAGAGAGAAAAAGGAGG - Intergenic
1041138523 8:54788424-54788446 GAAGGAAGAGGACAAGAAGGAGG - Intergenic
1041320049 8:56603504-56603526 GCAGAAAGCAGACAAAAGGTTGG + Intergenic
1042863916 8:73340228-73340250 GAAGTAAAAAGATAAAAAGAAGG + Intergenic
1043708205 8:83379392-83379414 GAAGTAAGAAGGACAAAAGGTGG - Intergenic
1043734976 8:83730740-83730762 GAAGTATGCAGACAAATGGATGG + Intergenic
1044531194 8:93309617-93309639 GAAGTAAGTAGAAACTAAGGTGG - Intergenic
1044999271 8:97866321-97866343 CATGTAAGCAGACAAAAATGAGG - Intergenic
1045131183 8:99155023-99155045 TAAGGAAAAAGACAAAAAGGTGG + Intronic
1045255738 8:100519374-100519396 GGAGGAAGCAGCCAACAAGGAGG + Intronic
1045392246 8:101726986-101727008 GAAGTAGGCAGACAAACACAAGG + Intronic
1045749819 8:105470171-105470193 GAAGGAAGAAGAAAAAGAGGAGG - Intronic
1048809408 8:138272155-138272177 GAAGTGAGGAGAGAAAAAGTTGG - Intronic
1050069234 9:1792972-1792994 GAAGAAAAGAGAGAAAAAGGGGG - Intergenic
1050264225 9:3872962-3872984 GAAGCAACCAAACAAAAAGCTGG + Intronic
1050411827 9:5374008-5374030 GAACTGAGAAGACCAAAAGGAGG - Intronic
1051202045 9:14637098-14637120 GAAGCAATAAGACAAAAAGTTGG + Intronic
1051516340 9:17934360-17934382 GAAGTAAGGTCATAAAAAGGTGG - Intergenic
1051688176 9:19680428-19680450 GAAGGAAGCAGACCACAGGGAGG + Intronic
1052359501 9:27538857-27538879 TAAGAAAGGAGAAAAAAAGGGGG + Intergenic
1053567387 9:39267649-39267671 CAAGTTATCAGGCAAAAAGGAGG - Intronic
1053833112 9:42105382-42105404 CAAGTTATCAGGCAAAAAGGAGG - Intronic
1054129756 9:61351349-61351371 CAAGTTATCAGGCAAAAAGGAGG + Intergenic
1054597440 9:67082027-67082049 CAAGTTATCAGGCAAAAAGGAGG + Intergenic
1055329945 9:75173341-75173363 GGAGTAAACTGACAAAGAGGAGG + Intergenic
1055506478 9:76954729-76954751 GTTGGAAGCAGACAAAATGGGGG - Intergenic
1055544473 9:77354716-77354738 GTAGTAAGCTGACACAATGGGGG - Intronic
1055964092 9:81848436-81848458 GAAGGCAGAAGAGAAAAAGGAGG - Intergenic
1057293261 9:93820437-93820459 GCAGTAAGGACACAAAAATGGGG - Intergenic
1058458839 9:105163771-105163793 GAAGTATACAGAGAAAAAGGTGG + Intergenic
1058526558 9:105865067-105865089 GAGGTAAGCATACAGAAGGGAGG + Intergenic
1059733169 9:117076392-117076414 GAAGGAAGGAGAAAAAGAGGGGG + Intronic
1061452716 9:130677350-130677372 GAACCAAGCAGACACAGAGGGGG + Intronic
1185516720 X:704829-704851 GGTGTGAGCAGACAAAAAGAAGG + Intergenic
1186970301 X:14834579-14834601 CAAGCAAGCATAGAAAAAGGTGG - Intergenic
1187278451 X:17837163-17837185 GAAGTGAGCACACAGATAGGTGG + Intronic
1188332150 X:28887506-28887528 GAAGGGAACAGACAAAGAGGAGG - Intronic
1191713423 X:64176914-64176936 AAAGGAAGAAGACAAAATGGTGG - Intergenic
1191879044 X:65826296-65826318 AAAATAAGTAGACAAAAAGCTGG + Intergenic
1192531026 X:71885850-71885872 AGAGTAAACAGACAAAAAAGTGG - Intergenic
1194084515 X:89509674-89509696 GGAGAAATCAGACAAAAAGAGGG + Intergenic
1195297346 X:103492089-103492111 GAAGGAAGCAGAGGAAAATGTGG - Intergenic
1195409888 X:104558721-104558743 GATGAAAGTAGAAAAAAAGGAGG + Intergenic
1196368974 X:114954103-114954125 AAAGAAAGCACACAAAAAGGGGG + Intergenic
1197275309 X:124472149-124472171 GAAGAGAGGAGACAAAAAGTTGG + Intronic
1197312098 X:124917290-124917312 CAAGTAACCAAACAACAAGGTGG - Intronic
1197381610 X:125749391-125749413 AAAGGAAAAAGACAAAAAGGAGG - Intergenic
1197867863 X:131037620-131037642 GAAGAAAACAGACACAATGGGGG - Intergenic
1197899806 X:131358494-131358516 GAAGTAAGCAGACAAAAAGGTGG - Intronic
1198096743 X:133387496-133387518 GAAGGAAGGAGAAAAAAAGAAGG + Intronic
1199066156 X:143421200-143421222 GAAGTAAGAAGAAAAAAAAAGGG - Intergenic
1199416746 X:147593129-147593151 TAAGAAAGCAAACAAAAAGTCGG + Intergenic
1200437156 Y:3165560-3165582 GGAGAAATCAGACAAAAAGAGGG + Intergenic
1201909727 Y:19121713-19121735 GAAGGAAACAGAGAAGAAGGAGG - Intergenic
1202578252 Y:26350445-26350467 GAAGTAAGAATACAAATAGAGGG - Intergenic