ID: 1197899892

View in Genome Browser
Species Human (GRCh38)
Location X:131359192-131359214
Sequence AGAGTTATGGAAGGAGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197899892 Original CRISPR AGAGTTATGGAAGGAGTGTT AGG (reversed) Intronic
900708122 1:4093416-4093438 ACAGTTATGACAGGTGTGTTGGG + Intergenic
901191229 1:7411171-7411193 ACAGTGATGGAAAGAGTGTGAGG - Intronic
901359963 1:8689224-8689246 AGAATTAAGGATGGAGTTTTTGG + Intronic
901588640 1:10319962-10319984 AGAGAAATGGAAGGAATATTGGG - Intronic
901863473 1:12089212-12089234 TGACACATGGAAGGAGTGTTAGG - Intronic
903541024 1:24096421-24096443 AGGGATCTGGAAGGAGTGGTGGG + Intronic
903819018 1:26086933-26086955 GGAGTTTTGGAAGGAGGTTTTGG - Intergenic
905145092 1:35882254-35882276 AGAGATTTGGAAGGATAGTTGGG + Intronic
906686557 1:47766910-47766932 AGAGAGATGGAAGGAGAGTCAGG + Intronic
907129413 1:52082299-52082321 AAAGTTATGGAAAGAATGTGAGG + Intronic
907917245 1:58882371-58882393 ACGGTTATGGAAGGTGTGGTGGG + Intergenic
909945946 1:81663075-81663097 ACAGTGGTGGGAGGAGTGTTAGG - Intronic
910705918 1:90129479-90129501 AGAGTTATGGGAGCAATGTATGG + Intergenic
912040998 1:105390491-105390513 ACAGTGATGGAAGGAGTAATGGG - Intergenic
912390978 1:109302650-109302672 AAAGTTATTGGAGGAGTGGTGGG - Intronic
912940367 1:114039478-114039500 AGACTTTTTGAAGGAGTGTAAGG + Intergenic
913637651 1:120779682-120779704 ATAGATATGTAAGGGGTGTTGGG + Intergenic
915516532 1:156415985-156416007 AGAGTTATGGAAGGAAGGGTGGG - Intronic
916701321 1:167298866-167298888 AGAATTATGGAAGGAAGGCTGGG + Intronic
921354401 1:214272847-214272869 ACTGTTATGGAAGAAATGTTTGG + Intergenic
921656925 1:217750618-217750640 AGAGTTATGGATGTATGGTTTGG + Intronic
921941328 1:220843061-220843083 AGAGTTGTGGTGGGAGTTTTGGG - Intergenic
922058917 1:222068892-222068914 AGAGTGAAGGAAGAAGTATTTGG + Intergenic
923078653 1:230633015-230633037 AGAGATAGGGAAGGTGTGTTAGG + Intergenic
923647101 1:235834863-235834885 ACAGGTATGGAAGGTGTGTTAGG - Intronic
924150541 1:241124801-241124823 AGAGCTATGGAAGTAGTGATAGG + Intronic
924712216 1:246538878-246538900 AGAGGGAAGGAAGGAGGGTTGGG + Intergenic
924824406 1:247524257-247524279 AGAGTAAGGGAAAGAGTGGTGGG - Intronic
1065251029 10:23814230-23814252 AGAGTTATGGGAGGAATGAGTGG + Intronic
1067523097 10:47022599-47022621 AGGAAGATGGAAGGAGTGTTAGG + Intergenic
1067733971 10:48834710-48834732 GGAGCTAGGGAAGGAATGTTAGG + Intronic
1069814607 10:71185879-71185901 AGAGTGATGGAAGGAGCTTTGGG - Intergenic
1071838325 10:89442014-89442036 AGACTAATGGCAGGAGTGATGGG + Intronic
1074223429 10:111460665-111460687 AGAGTCAGGGATGGAGTGCTGGG - Intergenic
1081230374 11:40578956-40578978 AGAGTTATCTAAGGAATTTTTGG - Intronic
1082282274 11:50282661-50282683 AGAGTTATGGTATCAGTGATGGG - Intergenic
1091020231 11:132092888-132092910 TGAGTTATCCAAGGAGTGATGGG - Intronic
1091260076 11:134226649-134226671 AGAGTTATGTATGCAGTGTGTGG - Intronic
1092725986 12:11485989-11486011 AGAGTTACGAAAGGAATGTCTGG - Intronic
1094632723 12:32192623-32192645 AGTGCTATGGAAGGAGAGTTTGG + Intronic
1094713065 12:32984927-32984949 AGAGTTATGAATGCAGTGGTTGG - Intergenic
1095569812 12:43672053-43672075 AGATTTGAGGAAGGAGTGTCAGG + Intergenic
1096660229 12:53119535-53119557 AGAGTTTTTGAAGGAGGGTAGGG - Intronic
1096679998 12:53249347-53249369 AGAGGTAGGGTAGGAGGGTTTGG - Intergenic
1097447071 12:59684568-59684590 AGATGTATCGAAGAAGTGTTAGG + Intronic
1098237381 12:68430558-68430580 AGAGCTATGGATAGAGTGATGGG - Intergenic
1098298179 12:69025856-69025878 AGTTTTATTGAAGGAGTATTAGG + Intergenic
1099052005 12:77791659-77791681 ATAGAGATGTAAGGAGTGTTAGG - Intergenic
1099975923 12:89545417-89545439 AGAATTATGGAACGAGTGCTGGG - Intergenic
1102800117 12:115724806-115724828 ATAGTGAAGGAAGGAGTATTAGG + Intergenic
1106203552 13:27566605-27566627 AGATTTAAGGGAGGAGAGTTGGG + Intronic
1107762239 13:43692024-43692046 AGAGTTAGGTAGAGAGTGTTTGG - Intronic
1108203383 13:48063664-48063686 ATAGATGTGGAAGGAGTGTGTGG - Intronic
1109644993 13:65242088-65242110 AGAGTTGAGGAAGGGATGTTTGG + Intergenic
1110291160 13:73808117-73808139 ATAGTTATGAAATAAGTGTTTGG - Intronic
1110785006 13:79513249-79513271 AGAGTTATGGAAAGGATTTTAGG + Intronic
1110852261 13:80259318-80259340 AGAGTAAGGGAAGCAGTGTTGGG + Intergenic
1110918507 13:81054278-81054300 AGCTGTGTGGAAGGAGTGTTAGG + Intergenic
1115880026 14:37905616-37905638 CTAGTTCTGGATGGAGTGTTTGG - Intronic
1116532073 14:45984391-45984413 AGAGTTTGAGAAGGATTGTTGGG + Intergenic
1117077752 14:52121744-52121766 AGAGTTTTTCAAGGAGAGTTTGG - Intergenic
1117293910 14:54361428-54361450 AGTGGGATGGAAGGAGTGTGAGG + Intergenic
1118183264 14:63514983-63515005 AGAGTTATGAAAAGAGGGATAGG - Intronic
1120145599 14:80975504-80975526 AGAGGCAGGGAAGGAGTGGTAGG - Intronic
1121519909 14:94578945-94578967 AGAGATTTGGAAGGAGTCTCGGG - Intronic
1121661692 14:95639991-95640013 AGAGTCATGGAGGGAGTGAGAGG + Intergenic
1122241741 14:100373021-100373043 AAAGTTACTAAAGGAGTGTTTGG - Intronic
1127332457 15:57952237-57952259 AGTGTAATGGAAGCAGTGGTTGG - Intergenic
1127812224 15:62574023-62574045 AGGGTTAAGGAAGGAGCCTTGGG + Intronic
1128225502 15:65998683-65998705 AGAGTTATGGCAGGAGGTTCGGG + Intronic
1128848966 15:70931826-70931848 ACAGTTTTGCCAGGAGTGTTAGG + Intronic
1129908440 15:79206369-79206391 TGAGTTTTGGAGGGAATGTTGGG + Intergenic
1132046871 15:98571042-98571064 TGATTTATGGAAGGACTATTTGG + Intergenic
1132511798 16:346414-346436 AGACTTAAGGAAGGAGGGATAGG + Exonic
1135845837 16:25917612-25917634 AGAGTTATGGAGGCAATGTCTGG + Intronic
1136077496 16:27827021-27827043 ACAGTGATGGAAGGGGAGTTGGG - Intronic
1139096166 16:63706851-63706873 AGAGTTTTGGCAGGATTGTTGGG - Intergenic
1140245127 16:73241486-73241508 AGAGTAATAAAAGGAGGGTTGGG + Intergenic
1144068964 17:11650209-11650231 AGAGTACTGGAAGGAGAGCTAGG + Intronic
1144325151 17:14172091-14172113 AGACAGATGGAAGGAGGGTTAGG - Intronic
1144474027 17:15568970-15568992 AGACAGATGGAAGGAGGGTTAGG - Intronic
1144535878 17:16091288-16091310 AAAGTTAAGGAAGGAGCATTCGG - Intronic
1146497804 17:33338358-33338380 AGAATTCTGGAAGAAGTGTATGG + Intronic
1148255510 17:46127966-46127988 AAAATTAGGGAAGGGGTGTTTGG - Intronic
1149436109 17:56634789-56634811 AAAGTTTTGGAAGGAGTGTTGGG - Intergenic
1152583465 17:81179111-81179133 AGAGTTCTGGAAGGTGGGTCAGG - Intergenic
1153314557 18:3709246-3709268 AGAGTGAAGGAAGGTGTGTAGGG - Intronic
1153810107 18:8744897-8744919 AGGCTTATGCAGGGAGTGTTTGG + Intronic
1155907141 18:31465566-31465588 AGAATTATCTTAGGAGTGTTGGG + Intronic
1156950724 18:42893814-42893836 AGAGTAATGAAAGGAGTGAGGGG - Intronic
1159242927 18:65766581-65766603 AGACTTAAGGAAGGAGTCCTTGG + Intronic
1161930273 19:7334858-7334880 GGAGATAGGAAAGGAGTGTTGGG + Intergenic
1163954219 19:20620385-20620407 AAAATTATGAAATGAGTGTTTGG - Exonic
1166114483 19:40645099-40645121 AAATTTATTGAAGGAGAGTTTGG + Intergenic
926669934 2:15567484-15567506 ATATTTATGGAAGGATTGATTGG - Intergenic
926782205 2:16483623-16483645 TGAGTTTTGCAAGGAGGGTTTGG + Intergenic
926951614 2:18249393-18249415 AGAGATATGAAAGTAGTGTGGGG + Intronic
927931474 2:27048271-27048293 AGACTTATTGAAGGAATGTAAGG - Intronic
928351935 2:30565790-30565812 AGAGTCATAGAAGGGGTGTAGGG + Intronic
928729341 2:34212576-34212598 AGAGGTTAGGAAGGAGAGTTGGG + Intergenic
929751774 2:44722524-44722546 AGAATTATGGTAGCAGTGTAGGG - Intronic
931813827 2:65880672-65880694 AGAGCTATGCAGGGAATGTTGGG + Intergenic
932660589 2:73648347-73648369 ATAGATAAGGATGGAGTGTTGGG - Intergenic
932944109 2:76207301-76207323 AGAGTTATGGAGGGTGAGTAGGG - Intergenic
933317733 2:80735998-80736020 AGAGTTGTTCAAGGATTGTTTGG - Intergenic
935959350 2:108409324-108409346 AGAGTGCTGGAAGGAGTGCGTGG + Intergenic
938228639 2:129638949-129638971 ATGGTTGTGGAAAGAGTGTTTGG + Intergenic
938228922 2:129640977-129640999 ATGGTTGTGGAAAGAGTGTTTGG - Intergenic
939718314 2:145614212-145614234 AGGAGTATGGAAGGTGTGTTGGG + Intergenic
939895853 2:147790707-147790729 AGAGGAACGCAAGGAGTGTTGGG - Intergenic
940280932 2:151988882-151988904 ATAGATATGGAAGGGGTGCTGGG - Intronic
940466016 2:154027680-154027702 AGAGTTAAGAAAAGAATGTTAGG + Intronic
940521363 2:154754235-154754257 AGGTTTATTGAAGGAGTGCTAGG - Intronic
942050163 2:172132427-172132449 GCAGTAATGAAAGGAGTGTTGGG + Intergenic
942715899 2:178891693-178891715 AGTTTTATGGAAGGAATGCTTGG - Intronic
944883323 2:204038032-204038054 AGATTTAAGTAAAGAGTGTTAGG + Intergenic
945181889 2:207100543-207100565 AGGGTTATGTAAGAAGTGATGGG - Intronic
946880866 2:224176021-224176043 AGAGTTAAGAAGGGTGTGTTTGG + Intergenic
948356193 2:237379529-237379551 ATTTTTAGGGAAGGAGTGTTTGG - Intronic
1168884289 20:1235325-1235347 AGAGTTACGGAAGCAGAGTAAGG - Intronic
1169307772 20:4507950-4507972 ATATTTATGGAAATAGTGTTGGG + Intergenic
1169525508 20:6420923-6420945 GAAGTGATGGAAGTAGTGTTAGG + Intergenic
1170119493 20:12896043-12896065 AGAATTATGGAAGGAGTGAAGGG + Intergenic
1170123631 20:12937622-12937644 AGAGTTATGCAAGTAGTGAGTGG + Intergenic
1170138839 20:13104924-13104946 AGAAGTAGGGAAGGACTGTTAGG - Intronic
1170163047 20:13335289-13335311 AGAGTTCTGGAAGGAGCATAGGG - Intergenic
1170490134 20:16864084-16864106 AGAGTAAGGGAAGCAGTGATGGG - Intergenic
1173814252 20:45974961-45974983 AGACTTATGGAAGCAGTGAAGGG + Intergenic
1174292528 20:49519235-49519257 AGAGTGATGGAAGGAGCAGTGGG - Intronic
1174892434 20:54410891-54410913 GAGGTTAAGGAAGGAGTGTTTGG - Intergenic
1175340426 20:58225930-58225952 AGACTGATGGAAGGAGAGATGGG + Intronic
1175527194 20:59643378-59643400 AGCCTTAAGGAAGTAGTGTTGGG + Intronic
1181359444 22:22323385-22323407 AGAGTGATGGGAGGAGGGTGAGG - Intergenic
1181489739 22:23254106-23254128 AGAGATGAGGAAGGAGTTTTTGG - Intronic
1181837117 22:25619965-25619987 AGAGTAAAGGAAGGAATGTGAGG - Intronic
1182824168 22:33248718-33248740 GGGGTTGTGGAGGGAGTGTTGGG - Intronic
1183058068 22:35319095-35319117 AGGGTGAGGGAAGGAGTGGTGGG + Intronic
1183286414 22:36967188-36967210 AGAGGTCTGGAAGCAGTGCTGGG - Intergenic
1184679936 22:46065298-46065320 AGAGTGAGGGAAGGAGCGTGCGG + Intronic
949659227 3:6258520-6258542 AGAGTTTTTGAAGGATAGTTTGG + Intergenic
949783570 3:7716290-7716312 TTAGTTATGGAACGAGTGTGGGG - Intronic
950914844 3:16633913-16633935 AGAATGATGGCATGAGTGTTAGG - Intronic
951530343 3:23693104-23693126 AGACTTAGGGAAGCAGTGATGGG - Intergenic
952869328 3:37884604-37884626 ACAGTCAGGGAAGGAGAGTTTGG + Intronic
957303727 3:78428510-78428532 ATAATTATGAAAGGAGTTTTGGG + Intergenic
958688431 3:97428905-97428927 AGAGTTAAAGAAGGAGGATTGGG - Intronic
959511631 3:107219528-107219550 AGTGTTAGGGAAGGCTTGTTGGG - Intergenic
962982941 3:140507155-140507177 TGAGTTAAGGAAGGAATGTCAGG + Intronic
963007111 3:140736818-140736840 AGTGCTGTGGAAGGAGTGATGGG + Intergenic
963390662 3:144659657-144659679 AGAGGTTTTGAAGGAGTGGTTGG - Intergenic
966493438 3:180553427-180553449 AGATTTATGGAAAGAATGTAAGG + Intergenic
967440107 3:189497580-189497602 AGACTTAAGGAATGAGTGCTGGG + Intergenic
969044188 4:4324672-4324694 AGAGTTTTGGGAGGAGTCATGGG - Intergenic
970861164 4:20704131-20704153 AGATTTCTGAAAGGAGTGGTTGG - Intronic
971692351 4:29853124-29853146 AAATTTATGTATGGAGTGTTAGG + Intergenic
975663411 4:76709536-76709558 AGAGTTATGGGAATGGTGTTAGG + Intronic
975984530 4:80190184-80190206 AGGGTGGTGGAAAGAGTGTTAGG + Intronic
976497210 4:85743993-85744015 AGAGCTATGGAATTATTGTTTGG + Intronic
977240206 4:94559339-94559361 AGAGCTATAGAAGAAATGTTTGG - Intronic
979446110 4:120813928-120813950 AGAGTTGTGGCAGGAGTGCAGGG - Intronic
980339617 4:131527538-131527560 ATATTTATGCAAAGAGTGTTTGG + Intergenic
981767103 4:148263462-148263484 AGAGTTATGGAAGAACCCTTGGG - Intronic
982269356 4:153570657-153570679 AGTGGTATGGAAGCTGTGTTAGG + Intronic
982454171 4:155588136-155588158 AGAGGGAAGGAAGGAGTATTGGG - Intergenic
983423619 4:167553400-167553422 AGATTTACAGAAGGAGTGTGTGG - Intergenic
987101276 5:14593257-14593279 AGAGGTATGTAAGCAGTGGTTGG + Intronic
987388450 5:17352714-17352736 AGTGCTAAGGAAGCAGTGTTTGG + Intergenic
987547535 5:19332321-19332343 AGAATGATGGAAGGAGTGGTTGG - Intergenic
988074991 5:26340944-26340966 AAAGGTAAGGAAGGAGAGTTTGG - Intergenic
988630705 5:32928363-32928385 AGAGGTCTGGAATGACTGTTAGG - Intergenic
989851240 5:46213964-46213986 AGAATTTTGGAAACAGTGTTTGG + Intergenic
990601392 5:57362151-57362173 TGCGTTATTGAAGGAATGTTTGG + Intergenic
992182881 5:74215167-74215189 AGAGGTAAGGAAGGAGTTCTAGG + Intergenic
999203468 5:149832597-149832619 AGACACATGGGAGGAGTGTTTGG + Intronic
1000697442 5:164405167-164405189 GGAGCTATGGAAGGCTTGTTAGG + Intergenic
1003135720 6:3433423-3433445 GGAGTGATGGGAGGAGTGTGGGG - Intronic
1003177592 6:3764317-3764339 GGAGTTGTGGAGGGAGTTTTGGG + Intergenic
1004355323 6:14925171-14925193 AAAGCAATGGAAGGAATGTTGGG + Intergenic
1005403575 6:25461147-25461169 AGAGATATGGAAGGAGTCTAAGG - Intronic
1005843655 6:29761174-29761196 GGAGATAGGGAAGGAGAGTTAGG - Intergenic
1005978840 6:30820475-30820497 AGAGTTATGAGAGGTGTGGTTGG + Intergenic
1007598993 6:43070248-43070270 AGAGTTGTGCAGTGAGTGTTGGG + Intronic
1010191207 6:73198970-73198992 AGTGTTACGGAAGAAGTCTTTGG + Intergenic
1010393874 6:75368388-75368410 ATATTTATTGAAGGAGTGATTGG - Intronic
1012576441 6:100806471-100806493 AGAGTTAGAGAACCAGTGTTAGG + Intronic
1016158556 6:140845780-140845802 AGAGCTATGTGAGGTGTGTTAGG + Intergenic
1018239184 6:161755321-161755343 AGAGTTATGGAGATAGTGTAGGG - Intronic
1020643915 7:10790527-10790549 AGATTTATGGAGGAAGTTTTTGG + Intergenic
1022795331 7:33727348-33727370 AAAGTGATGGGAGGAGTGTTTGG + Intronic
1023365607 7:39460370-39460392 TGAGTTGCGGATGGAGTGTTGGG + Intronic
1023959422 7:44914074-44914096 AGAGCTAGGGCAGGAGTGTGTGG - Intergenic
1024503970 7:50145491-50145513 AAGGATATGGAAAGAGTGTTGGG + Intronic
1026077970 7:67190722-67190744 AGAGTTATTGAAGCATTTTTAGG + Intronic
1027694882 7:81398053-81398075 ATTGTTAAGGAAGGAGTATTGGG + Intergenic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1029638629 7:101803635-101803657 AGAGTTATTGAAGGAGAGCAGGG + Intergenic
1030575817 7:111284525-111284547 AGAGTTTAGGGAGGAATGTTTGG + Intronic
1030838748 7:114321109-114321131 AAAGTTTTAGAAGGAGAGTTAGG + Intronic
1031810175 7:126357783-126357805 ATAGTGATTGGAGGAGTGTTCGG - Intergenic
1032404949 7:131649294-131649316 AGAGTTAGGGAACAGGTGTTAGG + Intergenic
1032493160 7:132340233-132340255 AGAGGGATGGGAGGAGTGTTTGG - Intronic
1034807468 7:154101625-154101647 AGATTTATATAAAGAGTGTTGGG + Intronic
1037832128 8:22195995-22196017 TGAGCTATGAAAAGAGTGTTGGG - Intronic
1038709913 8:29933906-29933928 AGGGTGCTGGAAGGAGTATTAGG - Intergenic
1039099973 8:33930438-33930460 AGAGACCTAGAAGGAGTGTTTGG - Intergenic
1039850679 8:41362448-41362470 AAAGTTTGGGAAGGAGGGTTGGG - Intergenic
1040637487 8:49291844-49291866 ACAGTGAGGGAAGGAGAGTTTGG - Intergenic
1040894393 8:52350547-52350569 AGAGTTAGAAAAGGATTGTTTGG - Intronic
1042036651 8:64540895-64540917 AGAGAGATGGAAGGAGTGGAAGG + Intergenic
1042095392 8:65210159-65210181 AAAGTTATGGAAGTACTGTGTGG + Intergenic
1043014018 8:74915602-74915624 AGAGTTAGGGATGGAGAGATGGG + Intergenic
1043133108 8:76486945-76486967 AGAGTTATGGCATAATTGTTTGG + Intergenic
1043488377 8:80721372-80721394 GGAGTTGTGGAAGGAGTGAGTGG + Intronic
1045006352 8:97919849-97919871 AGAGGTAAGCAGGGAGTGTTGGG + Intronic
1046214253 8:111121701-111121723 AGATTTATGGAAGTAATGTTTGG + Intergenic
1046337202 8:112805811-112805833 AGAGAAATGGAAGGAGAGTCAGG - Intronic
1046658944 8:116927700-116927722 AGAGTTGTGGATGCAGTGGTAGG + Intergenic
1047145051 8:122189035-122189057 AGGGTGATGGAAGGAGAATTTGG + Intergenic
1050669191 9:7977193-7977215 ACTGTTATGGAAGGAGGGTGGGG - Intergenic
1051907390 9:22111859-22111881 ACCATTTTGGAAGGAGTGTTTGG + Intergenic
1051964447 9:22810487-22810509 AGAGTTAGGGAAAGATTCTTAGG - Intergenic
1052790158 9:32868028-32868050 AGGATTGTGGCAGGAGTGTTGGG + Intergenic
1056933419 9:90897434-90897456 AAAATTATGAAAGGAGTGGTTGG + Exonic
1057164403 9:92914666-92914688 AGAGTCCTGGGAGGAGTATTGGG - Intergenic
1059793404 9:117664832-117664854 AGAGTCATTGAAGGAGTCTCAGG - Intergenic
1061776845 9:132971337-132971359 AGAAGCATGGAAGGAGTGTGGGG - Intronic
1186133402 X:6493942-6493964 AGAGTTATGCATGTAATGTTGGG + Intergenic
1186140784 X:6571019-6571041 AGAAATATGGAAGGAATATTAGG - Intergenic
1188459190 X:30403771-30403793 AGAGTTATAGAAAGAGGTTTAGG - Intergenic
1189605452 X:42672735-42672757 AGTGTTATGGAAAGACTGTGGGG + Intergenic
1189829373 X:44954922-44954944 ATGGTTATGGGAGAAGTGTTAGG + Intronic
1190061039 X:47211874-47211896 AGAGCTATGGAAGGAAAGATTGG - Intronic
1190448297 X:50553062-50553084 AGAGTTCTGAAAGGAGTGGGTGG + Intergenic
1193848967 X:86511969-86511991 AGAGTAATTGAAGGAATATTTGG + Intronic
1194449244 X:94022828-94022850 AGAGTCCTGGAAGGAGAGTGGGG + Intergenic
1195768288 X:108319891-108319913 AGAGAGATGGAAGAATTGTTGGG + Intronic
1197899892 X:131359192-131359214 AGAGTTATGGAAGGAGTGTTAGG - Intronic
1198368402 X:135967021-135967043 AGAGGGATGGAAGGAGTGAAAGG + Intronic
1201305302 Y:12544904-12544926 AGAGTTACTGAAGAAGTGTCTGG + Intergenic