ID: 1197907688

View in Genome Browser
Species Human (GRCh38)
Location X:131443705-131443727
Sequence CTCCACTTGCCTGTTGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197907678_1197907688 29 Left 1197907678 X:131443653-131443675 CCCTGCCCCTTGCGAAACCTCAC No data
Right 1197907688 X:131443705-131443727 CTCCACTTGCCTGTTGCCACAGG No data
1197907680_1197907688 24 Left 1197907680 X:131443658-131443680 CCCCTTGCGAAACCTCACAGTTT No data
Right 1197907688 X:131443705-131443727 CTCCACTTGCCTGTTGCCACAGG No data
1197907684_1197907688 12 Left 1197907684 X:131443670-131443692 CCTCACAGTTTGGATCTGCTTAG No data
Right 1197907688 X:131443705-131443727 CTCCACTTGCCTGTTGCCACAGG No data
1197907682_1197907688 22 Left 1197907682 X:131443660-131443682 CCTTGCGAAACCTCACAGTTTGG No data
Right 1197907688 X:131443705-131443727 CTCCACTTGCCTGTTGCCACAGG No data
1197907681_1197907688 23 Left 1197907681 X:131443659-131443681 CCCTTGCGAAACCTCACAGTTTG No data
Right 1197907688 X:131443705-131443727 CTCCACTTGCCTGTTGCCACAGG No data
1197907679_1197907688 28 Left 1197907679 X:131443654-131443676 CCTGCCCCTTGCGAAACCTCACA No data
Right 1197907688 X:131443705-131443727 CTCCACTTGCCTGTTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197907688 Original CRISPR CTCCACTTGCCTGTTGCCAC AGG Intergenic
No off target data available for this crispr