ID: 1197909790

View in Genome Browser
Species Human (GRCh38)
Location X:131468983-131469005
Sequence AGGAATAAACAGATGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197909790_1197909794 1 Left 1197909790 X:131468983-131469005 CCTTACTCCATCTGTTTATTCCT No data
Right 1197909794 X:131469007-131469029 CACCCCTTTCCTCCAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197909790 Original CRISPR AGGAATAAACAGATGGAGTA AGG (reversed) Intergenic
No off target data available for this crispr