ID: 1197910533

View in Genome Browser
Species Human (GRCh38)
Location X:131478813-131478835
Sequence CCCAGCCACATGGAGTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197910528_1197910533 -5 Left 1197910528 X:131478795-131478817 CCATGATTGTGAGGCCTCCCCAG 0: 4068
1: 6693
2: 4917
3: 2659
4: 1389
Right 1197910533 X:131478813-131478835 CCCAGCCACATGGAGTCATGAGG No data
1197910524_1197910533 25 Left 1197910524 X:131478765-131478787 CCACCATGTGAGACGTGCCTTCA No data
Right 1197910533 X:131478813-131478835 CCCAGCCACATGGAGTCATGAGG No data
1197910526_1197910533 8 Left 1197910526 X:131478782-131478804 CCTTCAGTTTCAGCCATGATTGT No data
Right 1197910533 X:131478813-131478835 CCCAGCCACATGGAGTCATGAGG No data
1197910525_1197910533 22 Left 1197910525 X:131478768-131478790 CCATGTGAGACGTGCCTTCAGTT No data
Right 1197910533 X:131478813-131478835 CCCAGCCACATGGAGTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197910533 Original CRISPR CCCAGCCACATGGAGTCATG AGG Intergenic
No off target data available for this crispr