ID: 1197913719

View in Genome Browser
Species Human (GRCh38)
Location X:131513361-131513383
Sequence GGGCCCATTGCACCAATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197913719_1197913736 24 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913736 X:131513408-131513430 CCCAAGCTGGGGGGTAGAGGAGG No data
1197913719_1197913729 11 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913729 X:131513395-131513417 GCTGCACTGTGGGCCCAAGCTGG No data
1197913719_1197913732 14 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913732 X:131513398-131513420 GCACTGTGGGCCCAAGCTGGGGG No data
1197913719_1197913733 15 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913733 X:131513399-131513421 CACTGTGGGCCCAAGCTGGGGGG No data
1197913719_1197913738 29 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913738 X:131513413-131513435 GCTGGGGGGTAGAGGAGGTGAGG No data
1197913719_1197913739 30 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913739 X:131513414-131513436 CTGGGGGGTAGAGGAGGTGAGGG No data
1197913719_1197913734 21 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913734 X:131513405-131513427 GGGCCCAAGCTGGGGGGTAGAGG No data
1197913719_1197913728 1 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913728 X:131513385-131513407 GGATGGGGTGGCTGCACTGTGGG No data
1197913719_1197913730 12 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913730 X:131513396-131513418 CTGCACTGTGGGCCCAAGCTGGG No data
1197913719_1197913727 0 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913727 X:131513384-131513406 AGGATGGGGTGGCTGCACTGTGG No data
1197913719_1197913731 13 Left 1197913719 X:131513361-131513383 CCATCAATTGGTGCAATGGGCCC No data
Right 1197913731 X:131513397-131513419 TGCACTGTGGGCCCAAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197913719 Original CRISPR GGGCCCATTGCACCAATTGA TGG (reversed) Intergenic
No off target data available for this crispr