ID: 1197917210

View in Genome Browser
Species Human (GRCh38)
Location X:131548968-131548990
Sequence AACTGAGTGCTACACTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197917210_1197917212 16 Left 1197917210 X:131548968-131548990 CCTGTAAAGTGTAGCACTCAGTT No data
Right 1197917212 X:131549007-131549029 AACTACTCTATAGTTATTTCAGG No data
1197917210_1197917213 20 Left 1197917210 X:131548968-131548990 CCTGTAAAGTGTAGCACTCAGTT No data
Right 1197917213 X:131549011-131549033 ACTCTATAGTTATTTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197917210 Original CRISPR AACTGAGTGCTACACTTTAC AGG (reversed) Intergenic
No off target data available for this crispr