ID: 1197921544 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:131599547-131599569 |
| Sequence | CTTTTTATGCTTAAGGAAGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197921542_1197921544 | 0 | Left | 1197921542 | X:131599524-131599546 | CCTGAGTTAAGATAGTTTACTTT | No data | ||
| Right | 1197921544 | X:131599547-131599569 | CTTTTTATGCTTAAGGAAGTAGG | No data | ||||
| 1197921541_1197921544 | 1 | Left | 1197921541 | X:131599523-131599545 | CCCTGAGTTAAGATAGTTTACTT | No data | ||
| Right | 1197921544 | X:131599547-131599569 | CTTTTTATGCTTAAGGAAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197921544 | Original CRISPR | CTTTTTATGCTTAAGGAAGT AGG | Intergenic | ||
| No off target data available for this crispr | |||||