ID: 1197921544

View in Genome Browser
Species Human (GRCh38)
Location X:131599547-131599569
Sequence CTTTTTATGCTTAAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197921542_1197921544 0 Left 1197921542 X:131599524-131599546 CCTGAGTTAAGATAGTTTACTTT No data
Right 1197921544 X:131599547-131599569 CTTTTTATGCTTAAGGAAGTAGG No data
1197921541_1197921544 1 Left 1197921541 X:131599523-131599545 CCCTGAGTTAAGATAGTTTACTT No data
Right 1197921544 X:131599547-131599569 CTTTTTATGCTTAAGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197921544 Original CRISPR CTTTTTATGCTTAAGGAAGT AGG Intergenic
No off target data available for this crispr