ID: 1197922209

View in Genome Browser
Species Human (GRCh38)
Location X:131607366-131607388
Sequence AAGAATCAACAGTAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197922209_1197922214 22 Left 1197922209 X:131607366-131607388 CCCTGCTCCTACTGTTGATTCTT No data
Right 1197922214 X:131607411-131607433 TTGTTATTATTTTGTATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197922209 Original CRISPR AAGAATCAACAGTAGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr