ID: 1197923495

View in Genome Browser
Species Human (GRCh38)
Location X:131621510-131621532
Sequence CCTCTTATAGTGTTGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197923490_1197923495 9 Left 1197923490 X:131621478-131621500 CCCATCCACAAAATAAAAATAGT No data
Right 1197923495 X:131621510-131621532 CCTCTTATAGTGTTGCTGGAAGG No data
1197923492_1197923495 4 Left 1197923492 X:131621483-131621505 CCACAAAATAAAAATAGTAATAG No data
Right 1197923495 X:131621510-131621532 CCTCTTATAGTGTTGCTGGAAGG No data
1197923489_1197923495 10 Left 1197923489 X:131621477-131621499 CCCCATCCACAAAATAAAAATAG No data
Right 1197923495 X:131621510-131621532 CCTCTTATAGTGTTGCTGGAAGG No data
1197923491_1197923495 8 Left 1197923491 X:131621479-131621501 CCATCCACAAAATAAAAATAGTA No data
Right 1197923495 X:131621510-131621532 CCTCTTATAGTGTTGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197923495 Original CRISPR CCTCTTATAGTGTTGCTGGA AGG Intergenic
No off target data available for this crispr