ID: 1197929590

View in Genome Browser
Species Human (GRCh38)
Location X:131680468-131680490
Sequence CCAGATTAGCATTTCATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197929590_1197929594 20 Left 1197929590 X:131680468-131680490 CCTGACATGAAATGCTAATCTGG No data
Right 1197929594 X:131680511-131680533 GTGAAGCCATCCTCATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197929590 Original CRISPR CCAGATTAGCATTTCATGTC AGG (reversed) Intergenic
No off target data available for this crispr