ID: 1197934465

View in Genome Browser
Species Human (GRCh38)
Location X:131726602-131726624
Sequence ATGCCCTTTGAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197934465_1197934469 28 Left 1197934465 X:131726602-131726624 CCTTCACTCTTCTCAAAGGGCAT No data
Right 1197934469 X:131726653-131726675 GGAGTAAAAGAAGCAATGATTGG No data
1197934465_1197934466 7 Left 1197934465 X:131726602-131726624 CCTTCACTCTTCTCAAAGGGCAT No data
Right 1197934466 X:131726632-131726654 TAAGTCCTTTTTCCATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197934465 Original CRISPR ATGCCCTTTGAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr