ID: 1197934466

View in Genome Browser
Species Human (GRCh38)
Location X:131726632-131726654
Sequence TAAGTCCTTTTTCCATGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197934465_1197934466 7 Left 1197934465 X:131726602-131726624 CCTTCACTCTTCTCAAAGGGCAT No data
Right 1197934466 X:131726632-131726654 TAAGTCCTTTTTCCATGATTTGG No data
1197934462_1197934466 15 Left 1197934462 X:131726594-131726616 CCAGAGGGCCTTCACTCTTCTCA No data
Right 1197934466 X:131726632-131726654 TAAGTCCTTTTTCCATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197934466 Original CRISPR TAAGTCCTTTTTCCATGATT TGG Intergenic
No off target data available for this crispr