ID: 1197934469 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:131726653-131726675 |
Sequence | GGAGTAAAAGAAGCAATGAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1197934465_1197934469 | 28 | Left | 1197934465 | X:131726602-131726624 | CCTTCACTCTTCTCAAAGGGCAT | No data | ||
Right | 1197934469 | X:131726653-131726675 | GGAGTAAAAGAAGCAATGATTGG | No data | ||||
1197934467_1197934469 | -7 | Left | 1197934467 | X:131726637-131726659 | CCTTTTTCCATGATTTGGAGTAA | No data | ||
Right | 1197934469 | X:131726653-131726675 | GGAGTAAAAGAAGCAATGATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1197934469 | Original CRISPR | GGAGTAAAAGAAGCAATGAT TGG | Intergenic | ||
No off target data available for this crispr |