ID: 1197945873

View in Genome Browser
Species Human (GRCh38)
Location X:131839929-131839951
Sequence CCAGATTAGCATTTCATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197945869_1197945873 20 Left 1197945869 X:131839886-131839908 CCTCTTCATGAGGATGGCTTCAC No data
Right 1197945873 X:131839929-131839951 CCAGATTAGCATTTCATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197945873 Original CRISPR CCAGATTAGCATTTCATGTC AGG Intergenic
No off target data available for this crispr