ID: 1197947005

View in Genome Browser
Species Human (GRCh38)
Location X:131850314-131850336
Sequence GTTTCATCAAGAATGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197947005_1197947006 -10 Left 1197947005 X:131850314-131850336 CCAGCATTCATTCTTGATGAAAC No data
Right 1197947006 X:131850327-131850349 TTGATGAAACCTCTCAACAAAGG No data
1197947005_1197947008 0 Left 1197947005 X:131850314-131850336 CCAGCATTCATTCTTGATGAAAC No data
Right 1197947008 X:131850337-131850359 CTCTCAACAAAGGAATGAAAAGG No data
1197947005_1197947009 22 Left 1197947005 X:131850314-131850336 CCAGCATTCATTCTTGATGAAAC No data
Right 1197947009 X:131850359-131850381 GAGCTTCTTCAACCTGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197947005 Original CRISPR GTTTCATCAAGAATGAATGC TGG (reversed) Intergenic
No off target data available for this crispr