ID: 1197947007

View in Genome Browser
Species Human (GRCh38)
Location X:131850336-131850358
Sequence CTTTTCATTCCTTTGTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197947007_1197947009 0 Left 1197947007 X:131850336-131850358 CCTCTCAACAAAGGAATGAAAAG No data
Right 1197947009 X:131850359-131850381 GAGCTTCTTCAACCTGATCAAGG No data
1197947007_1197947011 30 Left 1197947007 X:131850336-131850358 CCTCTCAACAAAGGAATGAAAAG No data
Right 1197947011 X:131850389-131850411 GTAAAACTTATCATACTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197947007 Original CRISPR CTTTTCATTCCTTTGTTGAG AGG (reversed) Intergenic
No off target data available for this crispr