ID: 1197947009

View in Genome Browser
Species Human (GRCh38)
Location X:131850359-131850381
Sequence GAGCTTCTTCAACCTGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197947004_1197947009 26 Left 1197947004 X:131850310-131850332 CCTACCAGCATTCATTCTTGATG No data
Right 1197947009 X:131850359-131850381 GAGCTTCTTCAACCTGATCAAGG No data
1197947003_1197947009 27 Left 1197947003 X:131850309-131850331 CCCTACCAGCATTCATTCTTGAT No data
Right 1197947009 X:131850359-131850381 GAGCTTCTTCAACCTGATCAAGG No data
1197947005_1197947009 22 Left 1197947005 X:131850314-131850336 CCAGCATTCATTCTTGATGAAAC No data
Right 1197947009 X:131850359-131850381 GAGCTTCTTCAACCTGATCAAGG No data
1197947007_1197947009 0 Left 1197947007 X:131850336-131850358 CCTCTCAACAAAGGAATGAAAAG No data
Right 1197947009 X:131850359-131850381 GAGCTTCTTCAACCTGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197947009 Original CRISPR GAGCTTCTTCAACCTGATCA AGG Intergenic
No off target data available for this crispr