ID: 1197947149

View in Genome Browser
Species Human (GRCh38)
Location X:131851756-131851778
Sequence ACTTATTAGCAGAAGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197947149_1197947154 21 Left 1197947149 X:131851756-131851778 CCCACCCTCTTCTGCTAATAAGT No data
Right 1197947154 X:131851800-131851822 GATAAATTGCCACAAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197947149 Original CRISPR ACTTATTAGCAGAAGAGGGT GGG (reversed) Intergenic
No off target data available for this crispr