ID: 1197955184

View in Genome Browser
Species Human (GRCh38)
Location X:131938902-131938924
Sequence ACTTGGAAGTTAAGCAGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197955184_1197955192 13 Left 1197955184 X:131938902-131938924 CCGACCCTGCTTAACTTCCAAGT No data
Right 1197955192 X:131938938-131938960 GGGTAGTATGGCCATAGATAAGG No data
1197955184_1197955188 -8 Left 1197955184 X:131938902-131938924 CCGACCCTGCTTAACTTCCAAGT No data
Right 1197955188 X:131938917-131938939 TTCCAAGTTCAGGCACGTTCAGG No data
1197955184_1197955189 -7 Left 1197955184 X:131938902-131938924 CCGACCCTGCTTAACTTCCAAGT No data
Right 1197955189 X:131938918-131938940 TCCAAGTTCAGGCACGTTCAGGG No data
1197955184_1197955194 15 Left 1197955184 X:131938902-131938924 CCGACCCTGCTTAACTTCCAAGT No data
Right 1197955194 X:131938940-131938962 GTAGTATGGCCATAGATAAGGGG No data
1197955184_1197955191 1 Left 1197955184 X:131938902-131938924 CCGACCCTGCTTAACTTCCAAGT No data
Right 1197955191 X:131938926-131938948 CAGGCACGTTCAGGGTAGTATGG No data
1197955184_1197955193 14 Left 1197955184 X:131938902-131938924 CCGACCCTGCTTAACTTCCAAGT No data
Right 1197955193 X:131938939-131938961 GGTAGTATGGCCATAGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197955184 Original CRISPR ACTTGGAAGTTAAGCAGGGT CGG (reversed) Intergenic
No off target data available for this crispr