ID: 1197955427

View in Genome Browser
Species Human (GRCh38)
Location X:131941737-131941759
Sequence CTAAGGTCCTTATATTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197955427_1197955430 17 Left 1197955427 X:131941737-131941759 CCTGGACAATATAAGGACCTTAG No data
Right 1197955430 X:131941777-131941799 TATGCCCCTCCTTTCTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197955427 Original CRISPR CTAAGGTCCTTATATTGTCC AGG (reversed) Intergenic
No off target data available for this crispr