ID: 1197962499

View in Genome Browser
Species Human (GRCh38)
Location X:132022630-132022652
Sequence CCACAAGTTCTGCACGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197962499_1197962507 22 Left 1197962499 X:132022630-132022652 CCTTACACGTGCAGAACTTGTGG No data
Right 1197962507 X:132022675-132022697 CGTTCTGCAAGGGATAGCCCAGG No data
1197962499_1197962510 30 Left 1197962499 X:132022630-132022652 CCTTACACGTGCAGAACTTGTGG No data
Right 1197962510 X:132022683-132022705 AAGGGATAGCCCAGGAGGTAGGG No data
1197962499_1197962504 11 Left 1197962499 X:132022630-132022652 CCTTACACGTGCAGAACTTGTGG No data
Right 1197962504 X:132022664-132022686 CCTAGTTTGGCCGTTCTGCAAGG No data
1197962499_1197962505 12 Left 1197962499 X:132022630-132022652 CCTTACACGTGCAGAACTTGTGG No data
Right 1197962505 X:132022665-132022687 CTAGTTTGGCCGTTCTGCAAGGG No data
1197962499_1197962509 29 Left 1197962499 X:132022630-132022652 CCTTACACGTGCAGAACTTGTGG No data
Right 1197962509 X:132022682-132022704 CAAGGGATAGCCCAGGAGGTAGG No data
1197962499_1197962501 -2 Left 1197962499 X:132022630-132022652 CCTTACACGTGCAGAACTTGTGG No data
Right 1197962501 X:132022651-132022673 GGTAGAGAGAAGCCCTAGTTTGG No data
1197962499_1197962508 25 Left 1197962499 X:132022630-132022652 CCTTACACGTGCAGAACTTGTGG No data
Right 1197962508 X:132022678-132022700 TCTGCAAGGGATAGCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197962499 Original CRISPR CCACAAGTTCTGCACGTGTA AGG (reversed) Intergenic
No off target data available for this crispr