ID: 1197967111

View in Genome Browser
Species Human (GRCh38)
Location X:132076895-132076917
Sequence CAGAACATGGAAAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 604}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197967111_1197967116 3 Left 1197967111 X:132076895-132076917 CCTCCCTCCTTTTCCATGTTCTG 0: 1
1: 0
2: 1
3: 54
4: 604
Right 1197967116 X:132076921-132076943 CTGTCCCTTTCCTTAGTAATAGG 0: 1
1: 0
2: 0
3: 19
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197967111 Original CRISPR CAGAACATGGAAAAGGAGGG AGG (reversed) Intergenic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
902184196 1:14712846-14712868 AAGCACAGGGAAAAGGTGGGGGG - Intronic
903145349 1:21368576-21368598 CAGACCGTGGGAAAGGAGAGGGG - Intergenic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903724178 1:25428957-25428979 CGTAGCCTGGAAAAGGAGGGTGG + Intronic
903763373 1:25715343-25715365 CAGAACATGGACTAGGAGTTGGG + Intronic
904420278 1:30386689-30386711 CAGAACAAGGAAGATGGGGGAGG + Intergenic
904915647 1:33968425-33968447 CAGAACATGAAAAAGGGGATGGG + Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905848999 1:41258900-41258922 GAGAATATGTAAAGGGAGGGAGG + Intergenic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
907496437 1:54848290-54848312 CTGAACATGGAAGTGGAAGGAGG + Intergenic
907592568 1:55689836-55689858 CAGAGCATGGATGAGGAGGTGGG + Intergenic
907593033 1:55693957-55693979 CAACACATGGAAAAGGAAGTTGG + Intergenic
907884875 1:58583696-58583718 CAGAACATAAAAAAGGAAGTTGG + Intergenic
908764750 1:67544407-67544429 GATAACATGGAAAAGCAGGTTGG - Intergenic
908911028 1:69072345-69072367 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
910368405 1:86490158-86490180 CAGAACAGGGCAGAGGAGAGGGG + Intronic
910604768 1:89071732-89071754 CAGCCCATGGAGAAGCAGGGTGG + Intergenic
910619453 1:89236585-89236607 GAGAACAAGAAAAAGCAGGGTGG - Intergenic
910666784 1:89734134-89734156 CAGTACCTGGAAAAGGAGAGAGG + Intronic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
912215972 1:107612787-107612809 CAGCAGCTGGAAAAGGAGGTAGG - Intronic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
914247412 1:145896452-145896474 CAGCACATGGATAAAGAGGTGGG + Intronic
914974315 1:152345787-152345809 TAGAACATAGAAATGAAGGGTGG - Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
916217427 1:162409422-162409444 CAGCTTTTGGAAAAGGAGGGTGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916555722 1:165892730-165892752 CAGAAGAATGTAAAGGAGGGAGG + Intronic
916986099 1:170192413-170192435 GAGAACAAAGAAAAGCAGGGTGG - Intergenic
917055007 1:170971384-170971406 CAGGACATAGAAAAGTAAGGTGG - Intronic
917269561 1:173258326-173258348 AAGAGCAAGGAAAAGCAGGGTGG + Intergenic
917660815 1:177175270-177175292 GAGACCATGGAAAAGCGGGGTGG + Intronic
917682838 1:177385094-177385116 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918696170 1:187549315-187549337 CAAAACAGGGTAAAGAAGGGTGG - Intergenic
919325287 1:196099610-196099632 GAGAAGATGGAAAAGTGGGGGGG + Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920447328 1:206028609-206028631 TAAAAGATGGAAAAGGAGGGAGG - Intergenic
920845240 1:209588139-209588161 CAGCACCAGCAAAAGGAGGGTGG + Intronic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921080520 1:211735518-211735540 CAGAACAAAGAAAAGGGGAGGGG - Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
922033465 1:221826085-221826107 CAGAACATGCAACAGGGGTGTGG - Intergenic
922358500 1:224798975-224798997 CAGAAAATAGGAAAGGAAGGGGG + Intergenic
924063533 1:240200791-240200813 GAGAACATGGAAAAAGAGTTGGG - Intronic
924313090 1:242766543-242766565 CAAATAATTGAAAAGGAGGGAGG + Intergenic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
1063192487 10:3709284-3709306 AAGTAAAGGGAAAAGGAGGGTGG - Intergenic
1063313328 10:4977709-4977731 CAGAAAATGGATAATTAGGGGGG - Exonic
1063314625 10:4990007-4990029 CAGAAAATGGATAATTAGGGGGG + Exonic
1063985313 10:11495434-11495456 AAGAAAATGGGAATGGAGGGAGG - Intronic
1064040789 10:11961498-11961520 CAGAAGAGGGAAGAGGAGGGAGG + Intronic
1065050373 10:21785800-21785822 AAAAAGATGGAAAAGGAGGAGGG + Intronic
1065323652 10:24531850-24531872 CAGGACTTGGAAAAGCTGGGGGG + Exonic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1065702818 10:28442216-28442238 CAGTGCTTGGGAAAGGAGGGAGG - Intergenic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066478699 10:35773816-35773838 TGGAACACGGAGAAGGAGGGGGG + Intergenic
1069360084 10:67632530-67632552 AAGAACAAAGAAAAGCAGGGTGG + Intronic
1069579873 10:69558775-69558797 GACAACATGAAACAGGAGGGAGG - Intergenic
1069591075 10:69642330-69642352 CAGAACACGGCAAAGGGGAGGGG - Intergenic
1069901798 10:71710707-71710729 CAGTACATGAAGAAGCAGGGAGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1071994491 10:91134521-91134543 CAGAATCTGGCAAGGGAGGGGGG - Intergenic
1072618483 10:97064777-97064799 TAAAGCATGGAAAAGGAAGGAGG - Intronic
1073225944 10:101919128-101919150 CAGAACAAGCAAAAAGGGGGAGG + Intronic
1073315773 10:102579840-102579862 CAGAACTTTGAAAAGGTAGGTGG + Intronic
1073735891 10:106345805-106345827 CAGAACATAGAATGGGAGGAAGG - Intergenic
1073918871 10:108436163-108436185 CAGAAGTTGGCAAAGGAGAGAGG - Intergenic
1075514524 10:123098406-123098428 CACAACAGGGAAAAGGACTGAGG + Intergenic
1076077354 10:127545062-127545084 GAGGAGAGGGAAAAGGAGGGAGG - Intergenic
1076222472 10:128745633-128745655 CAGAAGATGCAAGAGGAGGGAGG + Intergenic
1077078577 11:712533-712555 CAGGACTAGGAAAAGGAGGGAGG + Intronic
1077093779 11:790897-790919 CAGAGGCTGAAAAAGGAGGGTGG + Exonic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1078691139 11:13582125-13582147 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1079588134 11:22150493-22150515 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079818480 11:25094082-25094104 CAGATCAGGCAAAAGGAGAGAGG - Intergenic
1082992327 11:59218075-59218097 CATGACATGGAAGAGGAGTGTGG - Intergenic
1082993842 11:59233398-59233420 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1084428235 11:69097223-69097245 CAGGACACGGGAAAGGAGAGAGG - Intergenic
1085619894 11:78030170-78030192 AAGAACATGCAATTGGAGGGGGG - Intronic
1085668556 11:78439455-78439477 CAGAACAAAGAAAAGAAAGGGGG + Intronic
1086423309 11:86659106-86659128 CATAAAATTCAAAAGGAGGGTGG + Intronic
1087062422 11:93993252-93993274 GCGAACAGGGAAAAGGAGGGAGG - Intergenic
1087175629 11:95092472-95092494 AAGAAGATGGGAAGGGAGGGTGG + Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088098981 11:106132910-106132932 CAAAATGTGGAAAAGGAAGGTGG + Intergenic
1089092872 11:115892860-115892882 TAGAAATTAGAAAAGGAGGGAGG - Intergenic
1089654678 11:119938442-119938464 CCCAACATGGAGAGGGAGGGAGG - Intergenic
1090583091 11:128181153-128181175 TAGAAAATAGAAAAGGATGGGGG + Intergenic
1090981182 11:131724052-131724074 CAGAACAAGTCAGAGGAGGGAGG + Intronic
1092158136 12:6298236-6298258 CAAAACAGTGAAAAGGAGGCCGG + Intergenic
1093086393 12:14870031-14870053 GAGAACATAGAAAAGCAGGGTGG - Intronic
1095180656 12:39144158-39144180 GAGAACATGACAAAGAAGGGAGG - Intergenic
1095196094 12:39319243-39319265 CAGAACAGGTAAACTGAGGGAGG + Intronic
1095897967 12:47299784-47299806 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1096242799 12:49968247-49968269 CAAAACCTGGAAAGGTAGGGAGG - Intronic
1097498356 12:60372840-60372862 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1097625745 12:61998145-61998167 CAGAGCAAGTAAAAGGAGAGTGG + Intronic
1097928913 12:65162797-65162819 CAGTACATGGGACAGCAGGGTGG + Intergenic
1098201908 12:68064678-68064700 GAGAGCAAGGAAAAGTAGGGTGG - Intergenic
1098521527 12:71439652-71439674 CAGGACTTGGGAAAGGAGGGAGG + Intronic
1098857513 12:75669561-75669583 CAGAATATGGCAAAGGTAGGTGG + Intergenic
1099195754 12:79613843-79613865 CAGAAAATGGACAAGGCCGGGGG + Intronic
1099274148 12:80554052-80554074 CAGAGCCTGGAAAAGGTAGGAGG + Intronic
1101922260 12:108942530-108942552 CAGGAGATGGAAGCGGAGGGAGG + Intronic
1102052798 12:109875289-109875311 CCAAACAGGCAAAAGGAGGGAGG + Intronic
1102324466 12:111967955-111967977 CAGGAAATGGAAACTGAGGGAGG + Intronic
1102339779 12:112112507-112112529 TAGGACAGGGAAAAGGAGGGAGG + Intergenic
1103770122 12:123315929-123315951 AAGAACATGAAGATGGAGGGAGG + Intronic
1105436228 13:20380621-20380643 CAGAACCTGGAAGAGGCAGGAGG + Intergenic
1105816567 13:24041657-24041679 CAGAAAGTAGAAAAGAAGGGAGG + Intronic
1106581975 13:31026625-31026647 CAGCACATGGAACAGTATGGAGG - Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106708935 13:32311204-32311226 CCATAGATGGAAAAGGAGGGAGG + Intronic
1107174482 13:37384642-37384664 CAGAAGATGAGAAAGGAGGTTGG + Intergenic
1107310703 13:39074034-39074056 CAGCACATTGAGAAGGGGGGTGG - Intergenic
1107527292 13:41245884-41245906 CAGGACAGGGATAAAGAGGGAGG - Intronic
1108479658 13:50856009-50856031 GAGAACAAAGAAAAGCAGGGTGG + Intergenic
1109130611 13:58579762-58579784 CAGAACACGGGAAAGTAAGGGGG + Intergenic
1109918825 13:69028228-69028250 CAGAAGAGGCAAAAGGAAGGGGG + Intergenic
1110297589 13:73886457-73886479 CAGAAGATGGAAAAATAGGGGGG + Intronic
1111161120 13:84396088-84396110 CAGAATCTGAAAAAGGAGGTAGG + Intergenic
1111405532 13:87799627-87799649 AAGAGCATGGCAAAGTAGGGAGG + Intergenic
1112286787 13:98111714-98111736 AAGAGCATGGAAATGGAGGATGG - Intergenic
1112401930 13:99085816-99085838 CAAAACATGGAAGGAGAGGGAGG + Intronic
1112492234 13:99877379-99877401 CAGGGCAAGGAAAATGAGGGTGG - Intronic
1112901289 13:104360983-104361005 CAAAACATTAAAAAGCAGGGGGG - Intergenic
1112904703 13:104402524-104402546 CAGGACCTAGAAGAGGAGGGGGG + Intergenic
1112983514 13:105417459-105417481 CAGAAGATAAAAATGGAGGGAGG - Intergenic
1113061844 13:106330672-106330694 CAGCACAGAGAAAAGCAGGGAGG + Intergenic
1113303875 13:109054965-109054987 AAGAAGGAGGAAAAGGAGGGAGG - Intronic
1114958116 14:27848940-27848962 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1116401953 14:44518115-44518137 CAGAAAATAGAAGAGGAGGGAGG - Intergenic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1117288175 14:54307566-54307588 CAGAGCATCTAAAAGGAGAGTGG + Intergenic
1117479234 14:56126625-56126647 CACAAGATGGGAAAGGAGGGGGG - Intronic
1117721196 14:58630450-58630472 CAGAACAATGAAAAGCAGAGGGG + Intergenic
1117927983 14:60805057-60805079 TTGAACATGGCAAAGGAGGAAGG - Intronic
1118290247 14:64514049-64514071 TAGAGCATTGAAATGGAGGGTGG - Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118686103 14:68292669-68292691 CAGAAAGTGGAAAGGGAGGAGGG - Intronic
1119491575 14:75038607-75038629 CAGAAGATGTAAGGGGAGGGAGG + Intronic
1119511286 14:75213505-75213527 CAGGACATGGAAACGGAGAGAGG + Intergenic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1120818527 14:88889786-88889808 CTGAAGATTGAAAAGGAGGCAGG + Intergenic
1120819355 14:88897718-88897740 CAGAAAATGGATTAGGTGGGGGG - Intergenic
1121074976 14:91060418-91060440 GAGAAGATGGAGGAGGAGGGTGG - Exonic
1121716905 14:96082989-96083011 CAGAGCGTGGGAAATGAGGGTGG - Intronic
1122263194 14:100534782-100534804 CAGCACCAGGGAAAGGAGGGGGG + Intergenic
1122272912 14:100576347-100576369 CAGTGCATGGAGGAGGAGGGAGG - Intronic
1122930166 14:104929495-104929517 CAGGACAAGGAAAAGAAGTGAGG + Intronic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123472887 15:20568104-20568126 CTGAACATCTAAAAGGAGAGAGG + Intergenic
1123645118 15:22432249-22432271 CTGAACATCTAAAAGGAGAGAGG - Intergenic
1123666407 15:22612024-22612046 CTGAACATCTAAAAGGAGAGAGG - Intergenic
1123733192 15:23163095-23163117 CTGAACATCTAAAAGGAGAGAGG + Intergenic
1123751322 15:23360471-23360493 CTGAACATCTAAAAGGAGAGAGG + Exonic
1124283693 15:28384389-28384411 CTGAACATCTAAAAGGAGAGAGG + Exonic
1124299004 15:28527224-28527246 CTGAACATCTAAAAGGAGAGAGG - Exonic
1124320226 15:28706438-28706460 CTGAACATCTAAAAGGAGAGAGG - Exonic
1124437839 15:29665675-29665697 CAGCACAGGGGAAAGCAGGGAGG + Intergenic
1124482287 15:30088979-30089001 CTGAACATCTAAAAGGAGAGAGG + Exonic
1124488745 15:30141081-30141103 CTGAACATCTAAAAGGAGAGAGG + Exonic
1124543827 15:30610045-30610067 CTGAACATCTAAAAGGAGAGAGG + Exonic
1124754783 15:32397242-32397264 CTGAACATCTAAAAGGAGAGAGG - Exonic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1126176805 15:45743399-45743421 CAGAAATTGGGAAAGGAGGCAGG - Intergenic
1127361707 15:58250031-58250053 GAGAAAATGGAAAGGGATGGTGG + Intronic
1128565054 15:68695575-68695597 AAGAATATGAACAAGGAGGGAGG + Intronic
1128838658 15:70831994-70832016 CAGAACCTTGAAAACGAAGGTGG + Exonic
1129149242 15:73677312-73677334 AAGAACTTGGAAAAGGAGTAGGG + Intergenic
1129377119 15:75140666-75140688 AAGATCAGGGGAAAGGAGGGGGG + Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130819456 15:87479090-87479112 CAGAACAGAGCACAGGAGGGAGG - Intergenic
1130968938 15:88717538-88717560 CAGACGATGGCAATGGAGGGAGG + Intergenic
1130987237 15:88852474-88852496 CAGAAGAGGGAAATGGAAGGAGG - Intronic
1131827307 15:96331753-96331775 CAGAACGTGGAGAAAGAGGGAGG - Exonic
1132765282 16:1531410-1531432 CAGAACAGGGACACGGAGGGAGG - Intronic
1132931384 16:2460705-2460727 CAGCACCTGGAGAAGGCGGGTGG - Intronic
1133323298 16:4928139-4928161 CAAAAAATGAAAAAGGAGGCTGG - Intronic
1133491229 16:6271125-6271147 AAGAACATAGAAAAAGAGGCCGG + Intronic
1133978549 16:10617406-10617428 CAGGAAATGGAAAGAGAGGGCGG - Intergenic
1135637682 16:24093054-24093076 GAGAAGACAGAAAAGGAGGGAGG - Intronic
1135942428 16:26834220-26834242 AAGAAGAAGGAAGAGGAGGGAGG + Intergenic
1136939665 16:34510988-34511010 AAGAAGGAGGAAAAGGAGGGCGG - Intergenic
1136960155 16:34837572-34837594 AAGAAGGAGGAAAAGGAGGGCGG + Intergenic
1137438760 16:48480944-48480966 CAGAACAAAGAAAAGGTTGGGGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137724171 16:50645951-50645973 CAGGAGAGGGGAAAGGAGGGAGG + Intergenic
1139232192 16:65294432-65294454 CAGAAAACGGAAAAGGAGAGTGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140193400 16:72837168-72837190 GAGAAAATGGAAAAGGATGAAGG - Intronic
1140266950 16:73429103-73429125 CAAAAGATGAAAAAGGAAGGAGG - Intergenic
1141914914 16:87089037-87089059 TAGAACATCGCAAAGCAGGGAGG - Intronic
1142868275 17:2804510-2804532 AAGAATATGGGAAAGTAGGGCGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1143216968 17:5232475-5232497 CTGACCATGGAAAAAGAGGTGGG + Intronic
1143453380 17:7050324-7050346 CAGAAGGTGGACAGGGAGGGAGG + Intergenic
1143476763 17:7207600-7207622 CAGAAAATGGAAATGGAGGTTGG + Intronic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145780351 17:27559003-27559025 AACAATATGGAAAAGGAAGGAGG - Intronic
1145921418 17:28612987-28613009 CAGAACCAGGAAAAGAAGGTGGG + Intronic
1146122909 17:30210703-30210725 CAGGACAGTGAACAGGAGGGAGG + Intronic
1147490941 17:40865488-40865510 TTGAGCATGGAAAAGGAGGAAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149293550 17:55239888-55239910 CCTAACATGGACAAGGTGGGAGG + Intergenic
1150379380 17:64708603-64708625 CCGAACATGGAAATGGACAGAGG + Intergenic
1151309691 17:73285658-73285680 CAGAGCATGGGAGGGGAGGGAGG + Exonic
1151826594 17:76527408-76527430 CAGAAACTAGAAAAGGAGGACGG + Exonic
1151938148 17:77276327-77276349 AATAAAATGGAAAAGGAGAGAGG - Intergenic
1153162074 18:2217778-2217800 CACATCATGGAAAATGAGAGAGG + Intergenic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1154006409 18:10531925-10531947 CAACATATGGAAAAGCAGGGAGG + Intronic
1154025831 18:10706317-10706339 CAAAGGATGGAAAAGCAGGGTGG - Intronic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1154078254 18:11226464-11226486 GAGCATATGGAAAAGTAGGGAGG + Intergenic
1155280846 18:24238080-24238102 CAGTACATGGAAAATGATGTTGG - Intronic
1155526965 18:26726863-26726885 CAGAACAGGGCAAGGCAGGGTGG - Intergenic
1155923438 18:31628924-31628946 TTGAAGATGGAAAAGGAGGCAGG - Intronic
1156090820 18:33466631-33466653 CAGAGCAGGAAAAAGGGGGGTGG - Intergenic
1157397459 18:47354855-47354877 CAGAACATGCAAAAGGGAGTGGG + Intergenic
1157683460 18:49624891-49624913 GAGAACATGGAAACGAAGGTTGG - Intergenic
1157727090 18:49972980-49973002 AAGAATATGGAAAGTGAGGGAGG - Intronic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1158415580 18:57247192-57247214 GAGCACATGGGAGAGGAGGGAGG + Intergenic
1158689763 18:59649939-59649961 GGGCACATGGGAAAGGAGGGAGG + Intronic
1159200357 18:65175498-65175520 CATAACATGGAAAAGCAAGATGG - Intergenic
1159521307 18:69528263-69528285 TAGAACATGGGAAAGAATGGAGG - Intronic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1161086519 19:2338062-2338084 CAGAAGATGGAAAAGGGGCCAGG - Intronic
1161803675 19:6430094-6430116 CAGAGCATGGTCCAGGAGGGCGG - Exonic
1162972096 19:14186949-14186971 AAAAACAGGGAAAAGGATGGCGG - Intronic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164265380 19:23610925-23610947 GAGAACAAGAAAAAGCAGGGTGG - Intronic
1164599661 19:29552419-29552441 GAGAGCAAGGAAAAGCAGGGTGG + Intronic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1165128471 19:33617670-33617692 CAGAAAAGGGGAAAGGAGAGAGG + Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165390774 19:35537458-35537480 AAGCAAAGGGAAAAGGAGGGAGG + Intronic
1166500938 19:43340822-43340844 CAGAACAGAGACAAAGAGGGAGG - Intergenic
1166509159 19:43392628-43392650 CAGAACAGAGACAAAGAGGGAGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1168109464 19:54183858-54183880 CAGAACAGGGAAAGGGGAGGAGG - Intronic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
926052707 2:9755012-9755034 CAGAACATGGAAACGGAGCAAGG + Intergenic
926453772 2:13039932-13039954 GAGAGCGAGGAAAAGGAGGGTGG + Intergenic
927857174 2:26535054-26535076 CTGAACAGGGAATGGGAGGGTGG + Intronic
927928980 2:27032183-27032205 AAGAACAAGGAAGAGGATGGGGG - Intergenic
929193408 2:39161646-39161668 CAGACCTGAGAAAAGGAGGGTGG + Intergenic
931102421 2:59017387-59017409 CAGAAAAGGGGAAAGGAGGGAGG + Intergenic
931150795 2:59571064-59571086 CAGAAGGGAGAAAAGGAGGGAGG + Intergenic
931505071 2:62917201-62917223 CTAAACATGAAATAGGAGGGAGG + Intronic
933114798 2:78454982-78455004 AGGGGCATGGAAAAGGAGGGTGG - Intergenic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
933759040 2:85661838-85661860 GAGAGCATGGAAAAGGGGGATGG - Intronic
934635331 2:95982498-95982520 CAGAACATAGAAAAGCACCGAGG - Intronic
934798301 2:97122725-97122747 CAGAACATAGAAAAGCACCGAGG + Intronic
934835125 2:97580704-97580726 CAGAACATAGAAAAGCACCGAGG - Intronic
935605454 2:104968651-104968673 TAGAAAATGGAAAAGAAAGGTGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
938145587 2:128832499-128832521 AAGAAAAAAGAAAAGGAGGGAGG - Intergenic
939198409 2:139002638-139002660 CAGAAGATGGGAAAGCAAGGAGG + Intergenic
940057250 2:149525981-149526003 GAGAACAAAGAAAAGCAGGGTGG - Intergenic
940111926 2:150164115-150164137 CGGAACTTGGGAAAGCAGGGAGG + Intergenic
940875989 2:158897637-158897659 CAGGAGATGGAAAAAGGGGGTGG - Intergenic
940974412 2:159927075-159927097 CAGAGCAGGGTAAAGAAGGGTGG + Intergenic
941773289 2:169364864-169364886 CAGAAGAGGGGAAAGGAGGGAGG + Intergenic
941942330 2:171053783-171053805 CAGGACCTGGAAAAGAAGGAGGG - Exonic
942582194 2:177430642-177430664 GAGAACAAAGAAAAGGAGGGTGG - Intronic
942909523 2:181226383-181226405 GAGAAGGTGGAAAAGGAGGCAGG - Intergenic
944096301 2:195972684-195972706 CAACACATGGAAAACCAGGGAGG + Intronic
944324036 2:198382555-198382577 AATAACATGGAGCAGGAGGGAGG + Intronic
945024414 2:205606398-205606420 GAGAGCAAGGAAAAGCAGGGTGG - Intronic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
946691203 2:222309628-222309650 CAGGACATTCAAAAGCAGGGTGG + Intergenic
947411277 2:229843114-229843136 CAGAGCCTGGGAAAGGGGGGTGG - Intronic
947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG + Intronic
947864553 2:233387316-233387338 CTCAGCATGGAAATGGAGGGAGG - Intronic
948649471 2:239431581-239431603 CAGAGCATGGAACTGGAGGTAGG - Intergenic
948857651 2:240737540-240737562 AATAACAAGGAAAGGGAGGGAGG + Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1169147411 20:3261931-3261953 CAGAAAATGTGGAAGGAGGGTGG + Intronic
1169264885 20:4161712-4161734 CAGGTCAGGGAAAAGCAGGGCGG - Intronic
1170567790 20:17616544-17616566 CAGAGCATGGAACAGAAAGGTGG - Intronic
1170594042 20:17792271-17792293 AAGGACATGGGAAAGGAGGTGGG + Intergenic
1170756751 20:19212314-19212336 CCGACCATGGAATAGGCGGGCGG + Intergenic
1171051613 20:21864824-21864846 CTGGACATGGCAGAGGAGGGAGG + Intergenic
1172496631 20:35390448-35390470 CAGAAAGTAGAAAAGCAGGGTGG + Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172703300 20:36865192-36865214 GAAGACTTGGAAAAGGAGGGGGG - Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173447619 20:43134170-43134192 CACAACAAAGAAAAGGAAGGGGG + Intronic
1173585710 20:44181667-44181689 CAGAGCATGCAAAAGCTGGGAGG - Intronic
1174056178 20:47800118-47800140 CAGGACATTGAAAAGAAAGGAGG - Intergenic
1175175121 20:57106885-57106907 CAGAACATGGAGGAAGAGAGAGG - Intergenic
1175638597 20:60606803-60606825 CTGAACGTGGAAAAGGAGGTGGG - Intergenic
1177219955 21:18179665-18179687 AAGTACAAGGAAAAGGAGAGTGG - Intronic
1177638737 21:23819026-23819048 GACAACATGTGAAAGGAGGGAGG + Intergenic
1177788474 21:25696435-25696457 AACAACATGAAAAAGGAAGGGGG - Intronic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1178151774 21:29803169-29803191 AAGAACATGGAACAGCCGGGAGG - Intronic
1179291283 21:40020356-40020378 CAAAACAAGGAAAAGAAGGAAGG - Intronic
1179440634 21:41391041-41391063 CAGGGCATGGGAAGGGAGGGAGG + Intronic
1180179298 21:46110952-46110974 CAGGACTTTGATAAGGAGGGAGG - Intronic
1180647017 22:17347771-17347793 GAGGACATGGGAAGGGAGGGGGG - Intergenic
1181359621 22:22324366-22324388 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181369693 22:22406104-22406126 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181901411 22:26159395-26159417 GAGAACATGGAACAGGAGCTGGG + Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1183526501 22:38326212-38326234 CTGAAGATGGAAGAGGAGGGAGG - Intronic
1183543055 22:38441023-38441045 AAGGGCATGGAAAAGGAGAGGGG + Intronic
1183819570 22:40334496-40334518 CAGAACAGGGATGAGGTGGGTGG - Exonic
1185025844 22:48411496-48411518 CCCAACATGTAAAAGCAGGGAGG + Intergenic
1185147182 22:49144796-49144818 CAGAATTTGGTAATGGAGGGGGG + Intergenic
1185413976 22:50699825-50699847 CAGAACAAGGCCAAGGAAGGAGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949837526 3:8285523-8285545 CAGAAGGTGGAAAGGGAGGTAGG - Intergenic
949926992 3:9049307-9049329 AGGACCATGGAAAAGGAGAGAGG - Intronic
950115142 3:10445902-10445924 CAGAAGATGGCCAAGCAGGGTGG + Intronic
950181879 3:10919092-10919114 TAGAACAGGGAAAGGGAGGGAGG - Intronic
950402862 3:12783766-12783788 TAGAGCATGGAAAGGGAGGTGGG + Intergenic
953737445 3:45508497-45508519 CAGAACAAGGAAGAAGAGGAAGG + Intronic
954213649 3:49112158-49112180 CAGAGCCTGGTAAAGTAGGGTGG + Intronic
954268404 3:49488242-49488264 CATAAGATGGAAGAGGAAGGAGG - Intronic
954382954 3:50229314-50229336 AAGGACAAAGAAAAGGAGGGAGG + Intronic
954852709 3:53617071-53617093 CAGGACTTGGAAAAGCAGAGAGG - Intronic
955052967 3:55430462-55430484 CAGAGGATGGGAATGGAGGGAGG + Intergenic
955064874 3:55525642-55525664 CACAACATGGAATGGGAAGGGGG + Intronic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955713710 3:61806419-61806441 CAGAACCTGGATAAGGATGATGG - Intronic
955938310 3:64123817-64123839 GAGAACAGGGAAAAAGATGGGGG - Intronic
956103388 3:65791541-65791563 CAGAAAAGAGAAAGGGAGGGAGG + Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956619209 3:71203919-71203941 AAGCTCATGGAAAAGGAAGGAGG + Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
956682275 3:71791880-71791902 CAGACCTAGGAAAAGGAGGTGGG - Intergenic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
957560282 3:81812830-81812852 CAGAGCCTGGCAAAGCAGGGAGG + Intergenic
959144938 3:102533183-102533205 GACTACATGGAGAAGGAGGGAGG - Intergenic
960004131 3:112764685-112764707 AAAAATATAGAAAAGGAGGGAGG + Intronic
960272433 3:115689660-115689682 CAGAATGTGAAAAAGGAAGGTGG + Intronic
960335610 3:116414002-116414024 AAGAAGGTGGAAAAGGAAGGAGG + Intronic
960496369 3:118380345-118380367 TAGAAAAAGGAAAAGGAAGGGGG + Intergenic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
960634322 3:119768447-119768469 CAGAACATGCACCAGGAGTGGGG + Intergenic
960991220 3:123312951-123312973 CTGAACATGGGGCAGGAGGGAGG + Intronic
961518658 3:127454617-127454639 CAGTACATGGCATATGAGGGTGG + Intergenic
961749009 3:129084756-129084778 CAGCACATGGCAGAGGAGGCCGG - Intergenic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963749977 3:149167110-149167132 CAGAACATGGACACTGAGGCCGG - Exonic
964103192 3:153011206-153011228 AAGAACAAAGAAAGGGAGGGAGG + Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964525398 3:157611415-157611437 CAAAAGAGGAAAAAGGAGGGAGG + Intronic
964565347 3:158044796-158044818 CAGAAAATGGAAAAGGTAAGTGG + Intergenic
964612543 3:158629865-158629887 GAGAAGATAGAAAGGGAGGGAGG + Intergenic
965253290 3:166369511-166369533 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
965344453 3:167530961-167530983 CAGACCATGGCAAAGGAAGTTGG - Intronic
965618900 3:170622809-170622831 TAGCATATGTAAAAGGAGGGAGG - Intronic
966396990 3:179514368-179514390 CAGCCCATGGAAAAGCATGGTGG + Intergenic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967409375 3:189152013-189152035 CAGAACCTGGAATAGGAGTATGG + Intronic
967951882 3:194847618-194847640 CAAGGCATGGCAAAGGAGGGTGG + Intergenic
967974407 3:195024895-195024917 AAGAACATGGAAAACAAGGCCGG - Intergenic
969174854 4:5390657-5390679 CAGGACATAGGAAAGCAGGGAGG + Intronic
969309800 4:6346671-6346693 CAGAACTTGGCCAAGGAAGGAGG + Intronic
969355284 4:6621348-6621370 CAGGACAGGGAAAAGCAGTGCGG + Exonic
969936517 4:10687517-10687539 CAGGAAAGGGAAGAGGAGGGAGG + Intergenic
970557551 4:17249807-17249829 CACAACATGAAAAAGGAGATGGG + Intergenic
970813928 4:20131026-20131048 CAGAACATGCGACAGGAGTGTGG + Intergenic
971312238 4:25535397-25535419 CAGGACATGGAATATGGGGGAGG + Intergenic
971328396 4:25662914-25662936 CAGAACAATGAAAAGGGGGAGGG - Intronic
972572932 4:40327219-40327241 CAGAACAGGGCAGAGGATGGGGG + Intergenic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
972860902 4:43168657-43168679 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
974499600 4:62683691-62683713 GAGATCAAGGAAAAGCAGGGTGG + Intergenic
974763806 4:66313811-66313833 CTGAACATGGAAAAAGAGAAGGG - Intergenic
975059542 4:69979937-69979959 GAGAACATGGAAAAAGATGTAGG - Intergenic
975223050 4:71836271-71836293 TAGAAAGTGGAAAAGGAGGGAGG - Intergenic
975322360 4:73023191-73023213 CCTAAAATGGAGAAGGAGGGAGG - Intergenic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
976375576 4:84342025-84342047 GAGACCAAGGAAAAGCAGGGTGG + Intergenic
977033270 4:91915712-91915734 GAGATCATGTAGAAGGAGGGAGG + Intergenic
977428797 4:96904561-96904583 CTAAACATGGAGAGGGAGGGAGG + Intergenic
980333758 4:131441645-131441667 GAGAACAAAGAAAAGTAGGGTGG - Intergenic
980858354 4:138468146-138468168 AAGAATATGGAATAGAAGGGTGG + Intergenic
981169841 4:141609024-141609046 CAGAACTGGGAAAAGGATGGAGG + Intergenic
981242329 4:142492708-142492730 CAAAGCATAGAAAAGGAGGAAGG + Intronic
981391059 4:144192457-144192479 CAGAACATGATAAAGGAGACTGG - Intergenic
982566161 4:156989506-156989528 TAGAACATGGAATAGAAGTGAGG + Intergenic
983141399 4:164154528-164154550 CAGAACATGCAACAGGGGTGTGG + Intronic
983486102 4:168332554-168332576 CAGAGCCTGGAAAAGCAGGTGGG - Intergenic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984039711 4:174716060-174716082 CTAAACGTGGAAAAGCAGGGTGG + Intronic
984829296 4:183956814-183956836 CATAAAATGCAAAAGGAGGTTGG - Intronic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
984908780 4:184652849-184652871 AAGAAAAAAGAAAAGGAGGGAGG + Intronic
985286056 4:188337114-188337136 CAGCAGATGGGAAAGGTGGGCGG - Intergenic
985677750 5:1241019-1241041 CAGAAGCTGGAAGAGGCGGGAGG + Intronic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
986346679 5:6842094-6842116 AATAACATGGAAAAAGAGTGGGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
988110406 5:26812712-26812734 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
988111646 5:26830439-26830461 CAGAACATTGAAAATTAGGTGGG - Intergenic
988276286 5:29084993-29085015 CAGAACATAGACAATGAGGGAGG + Intergenic
989366763 5:40664597-40664619 CAGATCTTGTAAAAGGAGGTTGG + Intergenic
990231050 5:53712981-53713003 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
990940831 5:61201094-61201116 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
991179129 5:63728399-63728421 CTGAACATGGCAATTGAGGGAGG + Intergenic
991272138 5:64796764-64796786 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991272151 5:64796808-64796830 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991511130 5:67377309-67377331 CAGAACTGGGAAAAGGAGAGGGG - Intergenic
992384230 5:76268211-76268233 CAGATTCTGGAAAAGGTGGGAGG + Intronic
993615974 5:90113109-90113131 CAGAACATTCCAAAGGAGAGTGG + Intergenic
995245984 5:109936452-109936474 CAGCAAATGGAACAGCAGGGAGG - Intergenic
996583761 5:125062090-125062112 TGGAGAATGGAAAAGGAGGGTGG + Intergenic
996638962 5:125729982-125730004 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
996802734 5:127421484-127421506 CAGATCCTGGGAAATGAGGGAGG - Intronic
997223287 5:132188462-132188484 CAGAATATTGAATAAGAGGGAGG + Intergenic
997670465 5:135667105-135667127 CAGAACATGAAATAGGAGATTGG - Intergenic
997751076 5:136346444-136346466 CAGAACAGATAAAAGGAGGGAGG - Intronic
998072465 5:139208783-139208805 CAGAATGTGGAAAGGGAGAGGGG + Intronic
998230950 5:140361102-140361124 GTGGACATGGAAAAGCAGGGTGG + Intronic
998355922 5:141536563-141536585 AAAAACAGGGAAAAGGATGGGGG + Intronic
998778386 5:145628966-145628988 CAGAAAATGGGCAAGGAAGGTGG + Intronic
999698352 5:154205815-154205837 CAGAAGCTGGAAGAGGAGGAAGG + Intronic
1000096483 5:157975591-157975613 CAGCAAATGGAAAAAGAAGGTGG - Intergenic
1000636339 5:163647926-163647948 AAAAAAATGGAAAAGGAGGAAGG - Intergenic
1000747370 5:165050838-165050860 CAAAACAAGTAAAAGGATGGTGG - Intergenic
1001107216 5:168864878-168864900 TAGAAAATGGATAAGGACGGTGG + Intronic
1001945649 5:175775369-175775391 CAGAGTTTGGAAAAGGATGGGGG - Intergenic
1002255779 5:177957734-177957756 CAGTAAATGGAAAAGGAGCCAGG + Intergenic
1002783045 6:381387-381409 CATGAAATAGAAAAGGAGGGTGG + Intergenic
1002847780 6:963307-963329 GAGAAGATGGAAAAGGAGAGAGG + Intergenic
1002917064 6:1538048-1538070 AAGACCAAAGAAAAGGAGGGAGG + Intergenic
1003210385 6:4058960-4058982 CAGACCATGGAAAAGATGGAGGG + Intronic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1003902613 6:10668796-10668818 GAGAACAAAGAAAAGAAGGGTGG - Intergenic
1003944591 6:11062805-11062827 CAGAAAATAGAAGAGGAGGGAGG + Intergenic
1004355110 6:14923752-14923774 AAGAATATGGAAGAGGAGAGGGG - Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004884022 6:20034844-20034866 CAGAATTTCCAAAAGGAGGGAGG + Intergenic
1004979721 6:21009830-21009852 CAGAAAGTGGAAAGGGAGGTAGG + Intronic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005589753 6:27311651-27311673 CAGAAAAGGGAAAGGGAGGTTGG - Exonic
1006902389 6:37511601-37511623 AGGAACATGGCAGAGGAGGGAGG - Intergenic
1007680563 6:43630279-43630301 CAGAACACAGAAAGGCAGGGTGG + Intronic
1007698185 6:43747138-43747160 GGGGACATGGAAAAGGAGGAAGG - Intergenic
1008274108 6:49523544-49523566 GAGAACATGGATCTGGAGGGGGG - Intronic
1008326419 6:50187521-50187543 CAGGAGAGAGAAAAGGAGGGAGG - Intergenic
1008500331 6:52174638-52174660 CAGAACCTGGGAAAGATGGGAGG - Intergenic
1008694541 6:54019180-54019202 CAAAACATGGAAACAGAGGCCGG - Intronic
1009877578 6:69524580-69524602 CAGAACAGGACAAAGAAGGGCGG - Intergenic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1010389307 6:75319347-75319369 CAGAACATGAAAAAGGCCGAAGG + Intronic
1010708766 6:79146872-79146894 ATGAAGATGGAAAAGGAGAGTGG + Intergenic
1011381219 6:86744119-86744141 CAGCACCTGGCAAAGGAGAGGGG + Intergenic
1011545503 6:88478177-88478199 AAGCACATGGGAAAGGAGTGAGG + Intergenic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1012177041 6:96100700-96100722 CTTAACATGGAAAAGAAAGGGGG - Intronic
1012186128 6:96219337-96219359 CAGAACATGGCATAGAAGGTAGG + Intergenic
1012231718 6:96768259-96768281 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1012411205 6:98959584-98959606 AAGAACATGGAATAGAAGTGTGG - Intergenic
1012787558 6:103651198-103651220 CAAAACATGGAAAAAAAGGAAGG - Intergenic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1013806301 6:113999611-113999633 ATGAATTTGGAAAAGGAGGGAGG + Intronic
1014395525 6:120923604-120923626 CAGAATATGGCAAAAGAGGTGGG - Intergenic
1014590905 6:123268278-123268300 GAAAACCTGGAAAGGGAGGGTGG - Intronic
1015526042 6:134175866-134175888 CAGAACTTGGAAGAGGAGGAAGG + Intronic
1015582281 6:134738650-134738672 CAGGACAGTGAAAAGGAGGTAGG - Intergenic
1015845208 6:137513237-137513259 CAGTTCAAGGAAAAAGAGGGGGG + Intergenic
1016062524 6:139645570-139645592 GAGAACCTGGGAAAGGAGTGAGG + Intergenic
1016318723 6:142818982-142819004 CAGAAGAAAGGAAAGGAGGGAGG + Intronic
1016622290 6:146125693-146125715 CAGAATGGAGAAAAGGAGGGGGG - Intronic
1016625295 6:146159804-146159826 CAGAACAAGGCTCAGGAGGGAGG + Intronic
1016805401 6:148207143-148207165 GAGGACATGGAAAATCAGGGTGG - Intergenic
1016879443 6:148896466-148896488 CAGAACAATGAATAGGAGCGTGG - Intronic
1016898186 6:149074576-149074598 TAGGACATCGAAAAGGAGGATGG + Exonic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017943367 6:159073252-159073274 AAGAACATAGAAAAGGGGTGAGG - Intergenic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1018164856 6:161083690-161083712 AAGAAAATGGAAAAGGCGGAAGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018435805 6:163757961-163757983 CAGGACATGGAAACGAAAGGAGG - Intergenic
1018490673 6:164289403-164289425 CAGAACATGGAAAAGCAAAATGG - Intergenic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019152540 6:170018592-170018614 CAGAACCCGGAACAGGGGGGAGG + Intergenic
1019748869 7:2716422-2716444 CAGAGCATGGGTGAGGAGGGAGG + Exonic
1021011705 7:15476453-15476475 CAGAACATGGATAAGGGCGGTGG + Intronic
1021519562 7:21525793-21525815 CATAACATGGACAAGGGTGGAGG - Intergenic
1021655316 7:22868564-22868586 CAGAACTGGGATAAGGAGAGAGG - Intergenic
1022233856 7:28442235-28442257 CAGAACATGGATAAGCCCGGGGG - Intronic
1022846073 7:34211165-34211187 CTGACCAGGGAAAAGGAGGAAGG - Intergenic
1023328508 7:39086624-39086646 CACAATGTGGAAAAGGAGAGGGG - Intronic
1023552184 7:41382271-41382293 GAGAAAATGGAAAAGGAAGGAGG - Intergenic
1023583069 7:41701984-41702006 CAGAAAATGAAAAAGAGGGGAGG - Intronic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1024034474 7:45495579-45495601 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1024382737 7:48717681-48717703 GAGATCATGGAAAAGGATGAGGG + Intergenic
1024676637 7:51643683-51643705 CAGAACAGAGAAAAAGAGAGAGG - Intergenic
1024957723 7:54942144-54942166 GAGCATATGGAAAAGTAGGGAGG + Intergenic
1025236818 7:57240036-57240058 CAGGACATTGAAAAGAAAGGAGG + Intergenic
1026393968 7:69932407-69932429 GAGAAAATGGCAAGGGAGGGTGG + Intronic
1026638334 7:72103745-72103767 GAGAAGATGGAAATGGAGGGGGG + Intronic
1027569222 7:79842321-79842343 CAGAATATGGAAGAGGAGAAAGG - Intergenic
1027604212 7:80280121-80280143 CAGATCAAGGAAAGGGAGGGTGG + Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1028417348 7:90595321-90595343 CAGAACTTTAAAAAGGAGTGGGG - Intronic
1028509653 7:91610175-91610197 CAGGAGAGGAAAAAGGAGGGGGG + Intergenic
1028547285 7:92017198-92017220 GAGAACATGAAAAAGGAGATTGG + Intronic
1028627141 7:92889677-92889699 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1028686479 7:93594712-93594734 CAGAACGTGGATGAGGAGGGAGG + Intronic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029321385 7:99763823-99763845 TGGTACATGGAGAAGGAGGGAGG - Intronic
1029996160 7:105010528-105010550 AAAAACAAGGAAAAGGAGGTTGG + Intergenic
1030509040 7:110460483-110460505 AAGAAGATGGAAGAGGAGGAGGG + Intergenic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1031083947 7:117283864-117283886 CAGAAGATGGAAAATGAGAGAGG + Intronic
1032447664 7:131998623-131998645 CAGGGCATGGAGAAGGAGAGGGG + Intergenic
1033787759 7:144754437-144754459 CAGCTCATAGACAAGGAGGGAGG - Intronic
1034103591 7:148471935-148471957 CAGAACGAGAAAAAGGAGGAAGG + Intergenic
1034348339 7:150400588-150400610 TAACACATGGGAAAGGAGGGTGG + Intronic
1034468226 7:151242262-151242284 CAGAACAGGGACGAGGTGGGAGG + Intronic
1035352060 7:158253982-158254004 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352074 7:158254056-158254078 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352088 7:158254130-158254152 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352120 7:158254281-158254303 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352135 7:158254355-158254377 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352167 7:158254503-158254525 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352196 7:158254651-158254673 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1036029459 8:4951487-4951509 CAGAACAGGGAAAGGGAAAGAGG + Intronic
1036335815 8:7869032-7869054 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1036600071 8:10252607-10252629 CAGAAGCTTGAAAGGGAGGGAGG - Intronic
1037249662 8:16877457-16877479 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1037970975 8:23171667-23171689 CAGAACATGGACCAGGGTGGGGG + Intergenic
1038076444 8:24080432-24080454 CAGAAAATGTAAAAGGAGTGAGG - Intergenic
1038526223 8:28275960-28275982 CAGAACAGGAAAAAGGAGCCTGG - Intergenic
1038730857 8:30126449-30126471 GAGGACTTGGAAAAGGAGGTTGG - Intronic
1039862300 8:41469255-41469277 CAGAAAGAAGAAAAGGAGGGAGG - Intergenic
1040106560 8:43545348-43545370 CAGGACATGGAAAAAAAGAGCGG - Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1041746284 8:61212175-61212197 TAGAGCATGGAACTGGAGGGCGG - Intronic
1042759581 8:72256761-72256783 GAGAGCAAGGAAAAGTAGGGTGG + Intergenic
1042773537 8:72404951-72404973 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1042853624 8:73241600-73241622 CAGAACCTGGAGGAGGAGGTGGG + Exonic
1043803815 8:84645509-84645531 GAAAACATGGAAAAGGAGAAAGG - Intronic
1044875959 8:96666578-96666600 CAGAACATGGGAAAGTATGCTGG + Intronic
1044968687 8:97598520-97598542 CAGACAATGAAAAAGGAAGGAGG - Intergenic
1045097757 8:98816164-98816186 CAGGAAAAGGAAAAGGATGGAGG + Intronic
1047192571 8:122691452-122691474 CAAAACATGGGAAAGCAGGATGG - Intergenic
1047471083 8:125173131-125173153 CAGAACAGGGACAAAAAGGGAGG - Intronic
1048205415 8:132411680-132411702 GGGAGCATGGAAAAGGAGGGAGG - Intronic
1049291632 8:141806374-141806396 CAGGACATGGAAAGGAAGGAGGG - Intergenic
1049363134 8:142223806-142223828 GAGATCATGGATAAGGAGAGAGG + Intronic
1049429104 8:142550965-142550987 CAGGGCAGGGAAGAGGAGGGAGG + Intergenic
1050327267 9:4509531-4509553 AAGAACAGGGGAAGGGAGGGCGG + Intronic
1050381767 9:5038380-5038402 CAAAAAATAGAAAAGGAAGGAGG + Intronic
1050506272 9:6352595-6352617 CATATAATGGATAAGGAGGGTGG - Intergenic
1051459529 9:17295475-17295497 GAGAGCAAGGAAAAGCAGGGTGG - Intronic
1051975556 9:22943190-22943212 GAGAGCACGGAAAAGCAGGGCGG - Intergenic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052099422 9:24426382-24426404 TAGAATATGAAAAAGGAGAGAGG - Intergenic
1052379671 9:27756448-27756470 AGGAACAGGGGAAAGGAGGGTGG - Intergenic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1052737829 9:32362651-32362673 CAGACCTTGAAAAAGAAGGGTGG - Intergenic
1053162261 9:35821340-35821362 CATAACATGAATAAGGAGAGTGG + Intronic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1055030324 9:71767677-71767699 GAGATCCTGGTAAAGGAGGGGGG - Intronic
1055322985 9:75100348-75100370 GGGCACATGGACAAGGAGGGAGG - Intronic
1056134733 9:83621103-83621125 CAGAGCAGGGAAGAGAAGGGTGG - Intergenic
1056184979 9:84125646-84125668 CAGAATATGGGAAAGAAAGGTGG + Intergenic
1056186710 9:84142168-84142190 CAGAAGGTGGAAGAGGCGGGAGG + Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056543844 9:87596647-87596669 GAGAGCATGGGAAAGGAGTGAGG - Intronic
1056554455 9:87677158-87677180 CAATAAATGGAGAAGGAGGGAGG - Intronic
1057785093 9:98081381-98081403 CAGAATATGTAACAGGAGTGAGG + Intronic
1057848893 9:98549239-98549261 CAAAACATGGAAAAGAAGCCAGG - Intronic
1057858497 9:98621307-98621329 AAGAACTTGGAACTGGAGGGTGG - Intronic
1058039063 9:100284352-100284374 CAGAACAGCAAAAAGGAAGGCGG + Exonic
1058256966 9:102778339-102778361 CAGGACATGCAACAGGAGTGTGG - Intergenic
1058741101 9:107943362-107943384 CGGAACATGGAAGAGAAGAGAGG + Intergenic
1058837813 9:108875173-108875195 CAGAACAAGGTAAAGATGGGGGG + Intronic
1058953183 9:109922453-109922475 AAAAAGATGGAAAAGGAGGAAGG + Intronic
1059258608 9:112954349-112954371 CTGAACATGGAAAAGTCGAGAGG + Intergenic
1059637698 9:116187099-116187121 TAAAGGATGGAAAAGGAGGGGGG - Intronic
1060102825 9:120855882-120855904 CTGGAGAGGGAAAAGGAGGGAGG - Exonic
1060155412 9:121316858-121316880 CTGCACATGGGAAGGGAGGGCGG - Intronic
1060332613 9:122686800-122686822 CAGGACCTGGAAAAGAAGGAAGG + Intergenic
1060604985 9:124905622-124905644 CAGAAAATGGAATAAGAGGTGGG + Intronic
1060880857 9:127117085-127117107 CAGCACATGCAAAGGCAGGGAGG - Intronic
1061360456 9:130138550-130138572 CAGAGAAGGGAAGAGGAGGGAGG - Exonic
1062113359 9:134794932-134794954 TAAAACACGGAAAAGGTGGGTGG + Intronic
1185553468 X:1002245-1002267 CAGACCCTGGAGAAGGAGAGGGG + Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1186840785 X:13483076-13483098 CAGGACATGGAAAATGAGAAGGG + Intergenic
1186965133 X:14778792-14778814 CAGAATTTGGAAATGGAAGGTGG + Intergenic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1187637628 X:21249320-21249342 CAGGACAGGGATGAGGAGGGAGG + Intergenic
1187645994 X:21348147-21348169 GAGAACAAAGAAAAGCAGGGTGG + Intergenic
1187715483 X:22098187-22098209 CAGGACAGAGAAAGGGAGGGAGG + Intronic
1187794790 X:22991853-22991875 CAGAAGATAGAAAAGGAGGAGGG - Intergenic
1189826044 X:44918996-44919018 CAGATCATAAAAAGGGAGGGAGG + Intronic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1190230850 X:48580746-48580768 CAGAACATGGAACAAGGGTGTGG - Intergenic
1190868112 X:54401611-54401633 CAGAAGCTGGGAAGGGAGGGGGG - Intergenic
1190992390 X:55565982-55566004 GAGAACAAGGAAAAGCAAGGTGG + Intergenic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1191185653 X:57608064-57608086 AAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1191650884 X:63536854-63536876 GAGACCAAGGAAAAGCAGGGTGG + Intergenic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192436443 X:71146103-71146125 AAGAAAAAGGAAGAGGAGGGAGG - Intronic
1193018605 X:76764570-76764592 CAGAGAATGGAAAAGGTGAGTGG + Intergenic
1193844920 X:86456123-86456145 AAGAACAAAGAAAAGCAGGGTGG - Intronic
1194013713 X:88592999-88593021 CACAACATGAAAAAGGAAAGAGG + Intergenic
1194193411 X:90864786-90864808 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1195329011 X:103781207-103781229 CAGGGCATGGGAAAGGAGGGAGG + Intronic
1195588443 X:106595134-106595156 CAGAAACTAGAAAAAGAGGGAGG - Intergenic
1195812573 X:108851063-108851085 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1196158246 X:112454389-112454411 TATTACAAGGAAAAGGAGGGAGG + Intergenic
1196284602 X:113864303-113864325 GAGAGCAAGGAAAAGCAGGGTGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198806552 X:140500671-140500693 TAAAACAAGGAAGAGGAGGGAGG + Intergenic
1198864263 X:141104761-141104783 CAGAACATGGAAGACAATGGAGG - Intergenic
1198898426 X:141482655-141482677 CAGAACATGGAAGACAATGGAGG + Intergenic
1199028289 X:142965549-142965571 CAGAAAATGAATTAGGAGGGGGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199460337 X:148077097-148077119 CAGTACATGGAAGAGAATGGGGG - Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1199749103 X:150798100-150798122 CAGAACACAGGAAGGGAGGGAGG + Intronic
1200047391 X:153410109-153410131 CAGAAGCTGGAAGAGGTGGGTGG - Intergenic
1200089294 X:153626852-153626874 CAGAAGCTGGAAGAGGTGGGTGG + Intergenic
1200381417 X:155841421-155841443 CACAACATGGCAAATGAGGGAGG - Intergenic
1200523818 Y:4247135-4247157 GAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1200540022 Y:4447173-4447195 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1201417398 Y:13761123-13761145 CAAAACATGGAAAAGGAAATGGG - Intergenic
1201678752 Y:16619006-16619028 CAGACCATGGCAAAGGAAGTTGG + Intergenic