ID: 1197968350

View in Genome Browser
Species Human (GRCh38)
Location X:132089321-132089343
Sequence CTTGCATGGAGTATAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197968350_1197968352 2 Left 1197968350 X:132089321-132089343 CCTCACACTATACTCCATGCAAG No data
Right 1197968352 X:132089346-132089368 TACAAAAAAATAGCTCAAAATGG No data
1197968350_1197968353 25 Left 1197968350 X:132089321-132089343 CCTCACACTATACTCCATGCAAG No data
Right 1197968353 X:132089369-132089391 ATCATAGATCTAACTATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197968350 Original CRISPR CTTGCATGGAGTATAGTGTG AGG (reversed) Intronic