ID: 1197968350 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:132089321-132089343 |
| Sequence | CTTGCATGGAGTATAGTGTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197968350_1197968352 | 2 | Left | 1197968350 | X:132089321-132089343 | CCTCACACTATACTCCATGCAAG | No data | ||
| Right | 1197968352 | X:132089346-132089368 | TACAAAAAAATAGCTCAAAATGG | No data | ||||
| 1197968350_1197968353 | 25 | Left | 1197968350 | X:132089321-132089343 | CCTCACACTATACTCCATGCAAG | No data | ||
| Right | 1197968353 | X:132089369-132089391 | ATCATAGATCTAACTATAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197968350 | Original CRISPR | CTTGCATGGAGTATAGTGTG AGG (reversed) | Intronic | ||