ID: 1197968352

View in Genome Browser
Species Human (GRCh38)
Location X:132089346-132089368
Sequence TACAAAAAAATAGCTCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197968350_1197968352 2 Left 1197968350 X:132089321-132089343 CCTCACACTATACTCCATGCAAG No data
Right 1197968352 X:132089346-132089368 TACAAAAAAATAGCTCAAAATGG No data
1197968349_1197968352 6 Left 1197968349 X:132089317-132089339 CCTACCTCACACTATACTCCATG No data
Right 1197968352 X:132089346-132089368 TACAAAAAAATAGCTCAAAATGG No data
1197968348_1197968352 7 Left 1197968348 X:132089316-132089338 CCCTACCTCACACTATACTCCAT No data
Right 1197968352 X:132089346-132089368 TACAAAAAAATAGCTCAAAATGG No data
1197968347_1197968352 8 Left 1197968347 X:132089315-132089337 CCCCTACCTCACACTATACTCCA No data
Right 1197968352 X:132089346-132089368 TACAAAAAAATAGCTCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197968352 Original CRISPR TACAAAAAAATAGCTCAAAA TGG Intronic