ID: 1197968353

View in Genome Browser
Species Human (GRCh38)
Location X:132089369-132089391
Sequence ATCATAGATCTAACTATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197968351_1197968353 11 Left 1197968351 X:132089335-132089357 CCATGCAAGCGTACAAAAAAATA No data
Right 1197968353 X:132089369-132089391 ATCATAGATCTAACTATAAGAGG No data
1197968348_1197968353 30 Left 1197968348 X:132089316-132089338 CCCTACCTCACACTATACTCCAT No data
Right 1197968353 X:132089369-132089391 ATCATAGATCTAACTATAAGAGG No data
1197968350_1197968353 25 Left 1197968350 X:132089321-132089343 CCTCACACTATACTCCATGCAAG No data
Right 1197968353 X:132089369-132089391 ATCATAGATCTAACTATAAGAGG No data
1197968349_1197968353 29 Left 1197968349 X:132089317-132089339 CCTACCTCACACTATACTCCATG No data
Right 1197968353 X:132089369-132089391 ATCATAGATCTAACTATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197968353 Original CRISPR ATCATAGATCTAACTATAAG AGG Intronic