ID: 1197968353 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:132089369-132089391 |
| Sequence | ATCATAGATCTAACTATAAG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197968351_1197968353 | 11 | Left | 1197968351 | X:132089335-132089357 | CCATGCAAGCGTACAAAAAAATA | No data | ||
| Right | 1197968353 | X:132089369-132089391 | ATCATAGATCTAACTATAAGAGG | No data | ||||
| 1197968348_1197968353 | 30 | Left | 1197968348 | X:132089316-132089338 | CCCTACCTCACACTATACTCCAT | No data | ||
| Right | 1197968353 | X:132089369-132089391 | ATCATAGATCTAACTATAAGAGG | No data | ||||
| 1197968350_1197968353 | 25 | Left | 1197968350 | X:132089321-132089343 | CCTCACACTATACTCCATGCAAG | No data | ||
| Right | 1197968353 | X:132089369-132089391 | ATCATAGATCTAACTATAAGAGG | No data | ||||
| 1197968349_1197968353 | 29 | Left | 1197968349 | X:132089317-132089339 | CCTACCTCACACTATACTCCATG | No data | ||
| Right | 1197968353 | X:132089369-132089391 | ATCATAGATCTAACTATAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197968353 | Original CRISPR | ATCATAGATCTAACTATAAG AGG | Intronic | ||