ID: 1197973829

View in Genome Browser
Species Human (GRCh38)
Location X:132143846-132143868
Sequence GTAGAATTGTCAGCCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197973829_1197973832 16 Left 1197973829 X:132143846-132143868 CCACATCTGGCTGACAATTCTAC No data
Right 1197973832 X:132143885-132143907 GAGAAAGAAAAGATGTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197973829 Original CRISPR GTAGAATTGTCAGCCAGATG TGG (reversed) Intergenic
No off target data available for this crispr