ID: 1197980850

View in Genome Browser
Species Human (GRCh38)
Location X:132217471-132217493
Sequence GATGGTAATGCCCTTCCTAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197980850 Original CRISPR GATGGTAATGCCCTTCCTAT AGG Exonic
900334620 1:2155839-2155861 GGTGGTAATGCAGTTCCTAATGG + Intronic
903617198 1:24669244-24669266 GATGGTGATGCTCTTCGTTTAGG - Exonic
905603267 1:39272373-39272395 GATGCTCTTGCCCTGCCTATCGG - Intronic
908656520 1:66394567-66394589 GATCTTAATGCCCTTCTTGTGGG - Intergenic
914514804 1:148365026-148365048 GGTTGTAATGCCCTTTCAATTGG - Intergenic
918306356 1:183250390-183250412 GATGGTAATGCCAGTCCCAGGGG - Exonic
919527915 1:198678035-198678057 GATGGTATTGCATTTCCTCTTGG - Intronic
922032103 1:221811501-221811523 GAAGGTAATGACCTCCCTAAAGG + Intergenic
1062811948 10:473280-473302 GATGATGATGTCCTTCCTTTGGG - Intronic
1063720900 10:8580476-8580498 GATTGGAATGCCCATTCTATTGG - Intergenic
1065311882 10:24424184-24424206 GCTGTTAAGTCCCTTCCTATAGG - Intronic
1067101616 10:43338569-43338591 CATGGTCATGCCCCTCCTTTTGG - Intergenic
1072663219 10:97375642-97375664 GATGGTAATGACCCTCATTTTGG + Intronic
1078821870 11:14891345-14891367 GATGGTAATGCCGTTCTGACTGG - Intronic
1079617575 11:22513972-22513994 GAAGGGAATTCCCTTCCTCTAGG - Intergenic
1081356377 11:42119455-42119477 GGTGGTAATGCCCTCACTTTAGG + Intergenic
1082765603 11:57165131-57165153 GATGCTAATTTCCTTCCTTTGGG - Intergenic
1083859748 11:65413769-65413791 GATGCTCATGCCCTTCCTGAGGG + Intergenic
1086848284 11:91778772-91778794 GATGGTAATGCCTTTCTTCTAGG + Intergenic
1091457111 12:616259-616281 CATGGTAATGACCTTACCATTGG + Intronic
1092981714 12:13801518-13801540 GATGGTAAAGCCATTTCTACAGG - Intronic
1096396144 12:51268518-51268540 GAATGTAAAGCCCTTCCTTTAGG + Intronic
1100176549 12:92037355-92037377 GATGGTAAAACTCTTCCTCTAGG - Intronic
1105038621 12:132944477-132944499 GATGGAAATGCCGCTCCTGTTGG - Intronic
1105564922 13:21535859-21535881 GATAGTAATGCCTTCCTTATGGG - Intronic
1110044018 13:70806239-70806261 GATGCTGCTGCCCTTTCTATTGG + Intergenic
1113358176 13:109602844-109602866 GATGCTAATGCCAATCCTCTGGG - Intergenic
1116299470 14:43159241-43159263 GATGGTAGTGCCCTGCTTCTTGG - Intergenic
1117590374 14:57261946-57261968 GATGTTTATGCCCCTCCCATAGG - Intronic
1120654404 14:87171621-87171643 GATGGATTTGCTCTTCCTATAGG + Intergenic
1124210770 15:27763630-27763652 TATGGTAGGGCCCTTCCTGTGGG + Intronic
1128507295 15:68283243-68283265 GAGGGTAATGCTTTTCCTATAGG + Intronic
1138655042 16:58486627-58486649 GATGGTGGTGCCATTCCTAGAGG + Intronic
1141452327 16:84113346-84113368 GATGGTATTCCCGTACCTATGGG + Intronic
1146265380 17:31449360-31449382 CATAATAATGCCCTTCCCATGGG + Intronic
1148435119 17:47678094-47678116 GGTGATATTGCCCTTGCTATTGG + Exonic
1155032194 18:21994379-21994401 GCTGGGAATGCACTTCCCATTGG + Intergenic
1159894680 18:73985107-73985129 GATGGGGCTTCCCTTCCTATAGG + Intergenic
929238775 2:39632156-39632178 AATGTTAAGGCCCTACCTATGGG - Intergenic
929289853 2:40177840-40177862 AATGGTAATGATCTTCCTGTGGG + Intronic
938736910 2:134193986-134194008 GATGGTATTGCACCTCCTACTGG + Intronic
1169355232 20:4899664-4899686 GATCGCAGTGCCCTTCCTGTTGG - Exonic
1173234447 20:41231913-41231935 GATGGTAAAGCACCTCCTAATGG + Intronic
1174504173 20:51005939-51005961 GATGGGAAGCCCCTTCCTCTGGG + Intronic
1174704788 20:52644282-52644304 GATGGTAAGGCCTTTCCTGAAGG + Intergenic
950101235 3:10358255-10358277 GAGTGCAATGCCCTTGCTATTGG + Intronic
954140469 3:48602451-48602473 CCTGGTCATGCTCTTCCTATTGG + Intronic
954883374 3:53851161-53851183 GATCCTAATGCCCATCCTTTTGG + Intronic
958894296 3:99813092-99813114 GATGGTAATGCTCCTCATTTTGG + Intergenic
961906079 3:130264296-130264318 GAGGGTAATGCCCTTGCATTTGG - Intergenic
972452571 4:39217555-39217577 GATGGGAATGCCATACCTTTGGG + Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
975869460 4:78763210-78763232 TATAGTAATGCCCTGCGTATCGG - Intergenic
976324940 4:83760798-83760820 GTATGTAATGCCCTTACTATTGG - Intergenic
981774958 4:148355635-148355657 GATGGCCCTGCCCTTCCTGTAGG - Intronic
990448105 5:55911457-55911479 GAGGTTAAGCCCCTTCCTATGGG - Intronic
992116838 5:73546440-73546462 GATAGTAAAGCCCTTCCTGTTGG - Intergenic
994316512 5:98339464-98339486 GATGGTGATGACCTGGCTATCGG - Intergenic
996490546 5:124089747-124089769 TATGGTAATCACCTTCCTACTGG + Intergenic
996872015 5:128202276-128202298 GATGCTAATCACCTTCCTATAGG + Intergenic
1001793592 5:174483050-174483072 GATGTTACTGCCCTTCCCAGTGG + Intergenic
1002210416 5:177595654-177595676 GCTGGTAAAGCCCCTCCTCTTGG + Exonic
1003549412 6:7089188-7089210 AATGGTTATTGCCTTCCTATAGG + Intergenic
1003719130 6:8680885-8680907 GGTGGCATTGCCCTTCCTCTGGG - Intergenic
1008379609 6:50826320-50826342 GAGGGTGCTGCCCTGCCTATGGG + Intronic
1015321866 6:131885106-131885128 GATGGTAATCCCATTTCTACTGG - Intronic
1021470020 7:20991333-20991355 GATGGTAATCCACTTTTTATTGG + Intergenic
1028673162 7:93428259-93428281 GATAGTAGTGCCCTTCCCATAGG - Intronic
1033813219 7:145042447-145042469 GATGGAGATGCTCTTCCTAAAGG - Intergenic
1035971682 8:4256570-4256592 GAGGGTAAACCCCTTCCCATGGG - Intronic
1043693855 8:83193487-83193509 GATGGTAACACTCTTCCCATGGG - Intergenic
1050234272 9:3562047-3562069 GATGCTAGTGACCTTCCAATGGG + Intergenic
1051179767 9:14398232-14398254 GAAGTTAATCCCCTTCCCATAGG - Intronic
1053564113 9:39229798-39229820 AATGGAAATGCCCTTTTTATGGG - Intronic
1053830007 9:42069075-42069097 AATGGAAATGCCCTTTTTATGGG - Intronic
1054133035 9:61389236-61389258 AATGGAAATGCCCTTTTTATGGG + Intergenic
1054600549 9:67118378-67118400 AATGGAAATGCCCTTTTTATGGG + Intergenic
1055249731 9:74289026-74289048 AATGCTATTGCCCTTCCTGTTGG - Intergenic
1056472004 9:86914627-86914649 GATGGTAATACCCATTCTTTGGG + Intergenic
1056938204 9:90933815-90933837 ATGGGTAATGCCTTTCCTATGGG + Intergenic
1188879023 X:35469355-35469377 GATGGGAATGGGCCTCCTATAGG + Intergenic
1189039652 X:37529612-37529634 GATGTTCATGCCCTTTGTATGGG + Intronic
1192313956 X:70037747-70037769 GATGGTAATACCCGTCCTCTCGG + Exonic
1195105061 X:101595719-101595741 AATGGTAATGCACTTTCTTTTGG + Intergenic
1196023556 X:111015627-111015649 GTTGATAATGGCCATCCTATTGG + Intronic
1197834110 X:130676459-130676481 GATGGAAATCCCCTTTCTTTTGG + Intronic
1197980850 X:132217471-132217493 GATGGTAATGCCCTTCCTATAGG + Exonic
1199747430 X:150782420-150782442 GATGGGAATGCCCTCCCTCTAGG + Intronic