ID: 1197986256

View in Genome Browser
Species Human (GRCh38)
Location X:132269306-132269328
Sequence CAGTGCTAACAACTTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197986256_1197986262 17 Left 1197986256 X:132269306-132269328 CCCTGCTCAAGTTGTTAGCACTG No data
Right 1197986262 X:132269346-132269368 GAGATCAATAAATATTTTCTAGG No data
1197986256_1197986261 -5 Left 1197986256 X:132269306-132269328 CCCTGCTCAAGTTGTTAGCACTG No data
Right 1197986261 X:132269324-132269346 CACTGTGGTGGAAACGGAATAGG No data
1197986256_1197986264 30 Left 1197986256 X:132269306-132269328 CCCTGCTCAAGTTGTTAGCACTG No data
Right 1197986264 X:132269359-132269381 ATTTTCTAGGCCAGGCACAGTGG 0: 3
1: 62
2: 409
3: 2335
4: 8562
1197986256_1197986263 22 Left 1197986256 X:132269306-132269328 CCCTGCTCAAGTTGTTAGCACTG No data
Right 1197986263 X:132269351-132269373 CAATAAATATTTTCTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197986256 Original CRISPR CAGTGCTAACAACTTGAGCA GGG (reversed) Intergenic
No off target data available for this crispr